Introduction to Marine Biotech & the Environment

Introduction to Marine Biotech & the Environment

Our ever-growing human population subjects the marine environment to a wide variety of stresses. Fishery depletion, global warming, sewage contamination, pesticide and fertilizer run-off, oil spills, toxic algal blooms, movement of invasive species, and a variety of pollutants such as heavy metals are some of the burdens that are being placed on the marine environment.

The problems have grown progressively worse so that entire ecosystems are now affected. Fifty years ago pollution and habitat destruction altered local habitats such as an individual beach or bay. The problems now are global, affecting large sections of the planet. Currently, almost all coral reefs throughout their tropical range are being damaged by environmental stresses. And PCBs, industrial chemicals that bioaccumulate in the food chain, have been found in surprisingly high concentrations in remote areas such as above the Arctic Circle.

Marine biotechnology is providing researchers with a new set of molecular tools to develop strategies to understand and begin to try to manage affected ecosystems. These tools are being used to identify, monitor, and remediate environmental problems. This basic research using modern biotechnology tools helps to address environmental issues by unraveling the complex interrelationships of organisms and their environment.

Some of the major marine pollution problems addressed in this section include coastal pollution from fecal contamination, oil spills, and the deterioration of coral reefs. Activities are provided that address sampling by traditional monitoring techniques and new biotechnology methods of accessing and dealing with contamination and damage. Application of biotechnology techniques is now employed to help resolve some of these issues.

PDF file PDF file for this project

pdf IVA Introduction to Coral Reefs

ER IVA 19. Where Are Coral Reefs Found?

Background

Coral reef
Image Courtesy: Joe Pawlik, UNCW

Coral reefs are ecologically important ecosystems that support a diversity of life that surpasses even that of tropical rainforests. Coral reefs are home to an estimated 25 percent of all the kinds of life found in the oceans. Like rainforests, they serve as a rich store of genetic resources. They protect islands and continental coastlines from storm surges and erosion. They also provide fisheries resources, food, and income for indigenous people as well as large commercial operations. One coral reef forms the largest continuous living organism on the planet, the Great Barrier Reef in Australia.

Because they need sunlight to survive, coral reefs generally occur in clear tropical oceans to depths of up to only about 150 feet. Tropical corals prefer waters from 68 to 82oF (20 to 28oC). Consistent ocean temperatures in this range occur between the Tropic of Cancer and the Tropic of Capricorn. Corals that occur outside of this range are individual or colonial forms only and do not form the great reefs found in topical zones. Coral reefs occur in three different forms: fringing, such as in Hawaii, where the corals border the shoreline; barrier reefs, which form offshore with a lagoon between the reef and the land; and atoll reefs that form islands surrounding a central lagoon. Atolls are the tops of volcanic seamounts that lie near enough to the surface of the ocean for coral reefs to form. In this case the island is formed entirely by reefs. Atolls are low, only 7–9 feet above sea level, circular, and surround a central lagoon.

Islands in tropical zones are dependent on coral reefs for many services. The reefs protect the islands from ocean storms and provide a livelihood for many of the island residents. Sea level rise and coral loss due to bleaching exposes tropical islands to seawater encroachment. Many islands are under threat, including the Pacific’s Marshall Islands, Kiribati, Tuvalu, Tonga, the Federated States of Micronesia, and the Cook Islands. Antigua and Nevis in the Caribbean Sea and the Maldives in the Indian Ocean are also threatened. The population of these small islands totals more than 800,000 people. Islands that have supported human populations for thousands of years must now contend with inundation. Because they are generally already so low in elevation, atolls are under the most serious threat, but other islands with higher elevations may find their low-lying farmlands and fresh water supplies ruined by salt water invasion. Sea level is rising by 1 inch per year in much of the Pacific. In 30 years the lowest islands are predicted to be underwater. (Earth Island Institute 2000).

A better understanding of the process of coral bleaching may uncover solutions to help slow its progress.Biotechnology offers new tools that can help scientists discover the biological basis of coral bleaching.

PDF file PDF file for this project

 

Focus Questions

Where are the tropical zones and islands affected by climate change-induced sea level rise?

notepad

objectives

Students will:
• expand their knowledge of world issues and geography.

• be able to locate regions of the earth where corals grow and understand their importance to islands.

glass

materials

Coral bleaching reading assignment (IVA Introduction to Coral Reefs)

World maps with latitude, longitude, and islands

clock

teaching-time

10 minutes

 

testtubes

procedure

1. On a world map identify the tropical zones, areas where the sea temperatures range from 65 to 80oF. This is the area between the Tropic of Cancer and Tropic of Capricorn, 23.5-degree latitude north and south.

2. Identify and locate major coral reefs in the world, including the largest, the Great Barrier Reef, and the second largest reef, the Belize Barrier Reef.

3. Locate and identify three atoll islands susceptible to inundation by sea level rise as a result of reef deterioration: Tuvalu, Kiribati, and Maldives.

4. Discuss the issue of coral bleaching and climate change from the viewpoint of an island dweller.

  student-work
questionmark

questions

1. What are the possible impacts on tropical islands if coral bleaching and global warming both continue to increase?

2. Why is it important for scientists to try to understand the process of coral bleaching?

3. Where are the tropical areas that support corals?

  teacher-key
answermark

answers

1. What are the possible impacts on tropical islands if coral bleaching and global warming both continue to increase?

Because fringing reefs protect some of these islands from inundation by the sea, sea level rise and large storms could cause severe flooding. This inundation could completely destroy the lowest-altitude islands, meaning that 800,000 people will have to flee their homes and find someplace else to live.

2. Why is it important for scientists to try to understand the process of coral bleaching?

It may help find a way to slow or control the problem.

3. Where are the tropical areas that support corals?

Between the Tropic of Cancer and Tropic of Capricorn, 23.5-degree latitude north and south.

computer

references

Earth Island Institute’s Journal Sinking Islands: Vanishing Worlds. Accessed November 2005

The Equator, Hemispheres, Tropic of Cancer and Tropic of Capricorn. 1999. http://geography.about.com/library/misc/blequator.htm. Accessed July 2009.

KDE Santa Barbara. 2004. World Biomes: Coral Reef. http://kids.nceas.ucsb.edu/biomes/coralreef.html. Accessed July 2009.

ER IVA 20. Symbiotic Relationships in Coral Reefs

Background

Symbiosis is a condition in which two organisms live together. The relationship can take many forms. The most common are commensalism, where one organism benefits from activities of the other; parasitism, where one organism lives on another to the detriment of its host; or mutualism, where both organisms benefit from the association. Symbiotic relationships are developed to an extraordinary degree in coral reefs. The most common symbiotic relationship actually forms the reef itself. Microscopic plants, called zooxanthellae, live in the tissue of the coral animals. The photosynthetic zooxanthellae, living in the moist, protected environment of the coral’s tissues, produce food using sunlight as an energy source and coral wastes as nutrients. The carbon compounds formed by the zooxanthellae are diffused to the corals by osmosis and are the corals’ primary food supply. This relationship is called obligate mutualism because if one or the other partner dies the other cannot survive.

PDF file PDF file for this project

 

Focus Questions

What are the various types of symbiotic relationships and what types are found in coral reefs?

notepad

objectives

Students will define and recognize different types of symbiotic relationships.

glass

materials

Pencils
Student work sheet
Student reference sheet

clock

teaching-time

20 minutes

testtubes

procedure

Follow the instructions on the student work sheet

Student Reference Sheet

Symbiosis is a close association of animals or plants of different species. There are different types of symbiotic relationships:

Mutualism: Both organisms benefit from the association.

Aegism: An association in which one organism is protected by another without any harm to the host.

Inquilism: One organism shelters on or within another.

Endoecism: One organism shelters in the burrow or defensive structure of another.

Phoresis: One organism uses another for transportation.

Epizoism: A sessile organism lives on top of another organism.

Examples of Symbiosis

Corals and Zooxanthellae
Corals provide a moist environment and their waste products are a source of energy for zooxanthellae. Zooxanthellae produce organic compounds through photosynthesis and pass the compounds to the corals for food.

Clownfish and Sea Anemones
Clownfish hide among the tentacles of anemones and are protected from predators by the tentacles’ stinging cells. The anemone is not harmed but also does not benefit from the clownfish.

Remoras and Sharks
Remoras are cleaner fish, feeding on external parasites of sharks. The sharks benefit as the parasites are removed.

Hawaiian Cleaner Wrasse and Reef Fish
The wrasse set up cleaning stations on the reef and feed on the parasites and dead tissue of the fish that visit the cleaning stations.

Hawaiian Shrimp Goby and Snapping Shrimp (described in Gulko 1998)The Hawaiian shrimp goby uses the burrow of the snapping shrimp. The shrimp has poor eyesight and depends on the goby to guard the entrance to the burrow

Coral and Crustacean Guards (described in Gulko 1998)
Coral is the favorite food of the crown-of-thorns sea star. Some corals are protected from predation by the crown-of-thorns sea star by the crab and shrimp that live in the coral’s branches. The crab and shrimp will harass and attack the sea star to prevent it from eating the coral.

Trematode and Coral (described in Gulko, 1998)
The trematode Podocotyloides stenometra has a complex life cycle involving three hosts: a snail, coral, and finally a fish. The trematode first infects the snail, and then it infects coral by chewing its way into coral polyps. In the coral, the encysted flatworm lives off the energy reserves of the coral, severely depleting the energy resources of the coral and causing “coral zits,” or round, pink pimples. Certain fish feed preferentially on the infected coral colonies.

This information taken from Gulko (1998).

  student-work
questionmark

questions

Read the definitions and descriptions of symbiotic relationships in the Student Reference Sheet. Then place the appropriate symbols—+ (benefits), - (suffers), 0 (neither benefits nor suffers)—beneath the organisms to indicate if they benefit or suffer from the relationship. Write in the type of symbiotic relationship.

1. Corals and zooxanthellae symbiosis type ____________________

2. Clown fish and anemone symbiosis type ____________________

3. Remora and shark symbiosis type ____________________

4. Hawaiian shrimp goby and snapping shrimp symbiosis type_____________________

5. Hawaiian cleaner wrasse and reef fish symbiosis type_____________________

6. Coral crab and shrimp symbiosis type____________________

7. Trematode and coral symbiosis type_____________________

What other set(s) of organisms exhibit a symbiotic relationship? What type(s) of symbiosis?

  teacher-key
answermark

answers

1. Corals and zooxanthellae symbiosis type ___________________

Mutualism


2. Clown fish and anemone symbiosis type ____________________

Mutualism


3. Remora and shark symbiosis type ____________________

Mutualism


4. Hawaiian shrimp goby and snapping shrimp symbiosis type_____________________

Endoecism and mutualism



5. Hawaiian cleaner wrasse and reef fish symbiosis type_____________________

Mutualism



6. Coral crab and shrimp symbiosis type____________________

Mutualism

7. Trematode and coral symbiosis type_____________________

Parasitism

What other set(s) of organisms exhibit a symbiotic relationship? What type(s) of symbiosis?

Answers will vary

computer

references

Gulko, D. 1998. Hawaiian Coral Reef Ecology. Mutual Publishing, Honolulu, Hawaii.

ER IVA 21. Monitoring Coral Bleaching

Background

Because coral bleaching results from many environmental factors, defining the causes of bleaching is important for conservation of reefs. Recording the extent of the bleaching and what environmental factors were present at the particular coral reef at a given time is one of the first steps to establishing a direct link between an environmental factor (such as global warming) and coral reef health.

Further background on coral bleaching can be found in the Introduction to Coral Reefs (IVA Introduction to Coral Reefs ) document in this curriculum.

PDF file PDF file for this project

 

Focus Questions

How can the causes of coral bleaching be identified?

notepad

objectives

Students will describe monitoring that could be used to determine the cause or causes of coral bleaching.

glass

materials

Picture of coral reef included here
Ruler with cm markings
Introduction to Coral Reefs (IVA Introduction to Coral Reefs) reading from this curriculumStudent work sheet

clock

teaching-time

45 minutes

testtubes

procedure

1. Assign students to read the document Introduction to Coral Reefs and distribute copies of the student work sheet “Coral Bleaching in the Great Barrier Reef.” Direct students to examine the photo.

2. Lead the students in a discussion of the factors that are thought to cause coral bleaching and therefore must be measured to determine the cause of bleaching. These factors include:

• Elevated seawater temperatures
• Increased levels of ultraviolet irradiation
• Turbidity
• Chemical pollutants
• Coral diseases

3. Assign students the problem of designing an appropriate monitoring protocol to study coral bleaching and its causes. First they will need to determine the extent of the problem in their study area by confirming if the bleaching is spreading or shrinking and identifying the factors in the study area that are known to cause bleaching. Challenge students to develop as many ideas as possible and to list the methods they will use to gather measurements needed to answer the questions.

Let the students develop their own ideas for approaches to monitoring coral bleaching, then guide them with the suggestions given below. They should consider the following:

• Selection of an appropriate study site, a representative reef that is characteristic of the area

• Choice of methods or approaches to studying coral bleaching. These methods could include photography (analysis of photos of the study area taken at set intervals of time, monthly, every six months, etc.) and direct measurement (using quadrats to estimate the amount of bleaching in a selected area of the reef at specified intervals)

• Appropriate sampling frequency: should the reef be examined weekly, monthly, biannually, yearly? Sampling must be consistent. Discuss the need for consistent data collection techniques over time to determine extent of bleaching as well as environmental parameters

• Calculate the extent of bleaching, and compare to environmental stresses known to be occurring in the area. This information is needed in order to determine the cause(s) of the bleaching. Some of these stresses could be:

• Pollution—water testing will be needed

• Coral diseases—observations for disease diagnosis

•Water turbidity—water clarity measurements

•Warming water—temperature measurements

• Consistent periodic measurements are needed for all of the above to determine the cause(s) of coral bleaching. To establish if the problem is localized or more widespread, the sampling must be duplicated at different locations.

4. Have the students complete the activity outlined on the student work sheet.

  student-work
questionmark

questions

1. What parameters should be measured to identify the cause of coral bleaching?
1.
2.
3.
4.
5.

2. How will you know if bleaching in your study area is getting worse? Develop a sampling plan to determine if bleaching is spreading. Consider the following: Selection of sampling site How often to sample Methods to measure bleaching

3. Using the photograph above, estimate the amount of area of bleached coral in square centimeters. Measure a selected area that is bleached and estimate the percent of the reef that has been damaged by coral bleaching.

4. Would photography be a dependable method of measurement if you had access to aerial views of the reef?

Coral Reef
Bleached corals are white.
Photo: Great Barrier Reef Authority

  teacher-key
answermark

answers

1. What parameters should be measured to identify the cause of coral bleaching?

1. Seawater temperatures
2. Levels of ultraviolet irradiation
3. Turbidity
4. Chemical pollutants
5. Coral diseases

2. How will you know if bleaching in your study area is getting worse? Develop a sampling plan to determine if bleaching is spreading. Consider the following:

Selection of sampling site:

Choose a reef that is representative of reefs in the area. If you are trying to determine whether bleaching is localized or more widespread, you must set up sampling sites throughout the tropics. This is an important consideration if trying to determine if climate change is the cause of bleaching.

How often to sample:

Consistent periodic sampling is needed, whether weekly, monthly, biannually, or yearly. Students should remember that more frequent sampling is usually more expensive and may not be necessary to capture the variability or trends in their reef area.

Methods to measure bleaching:

Photography of sample area or use of quadrants and direct measurement of area of damaged coral to measure extent of bleaching. Various methods to measure causative parameters.

3. Using the photograph above, estimate the amount of area of bleached coral in square centimeters. Measure a selected area that is bleached and estimate the percent of the reef that has been damaged by coral bleaching.

About 50 percent


4. Would photography be a dependable method of measurement if you had access to aerial views of the reef?

This method is useful if the site and angle of the photographs are carefully chosen to be consistent from photo to photo.

computer

references

Australian Institute of Marine Science. 2003. What is coral bleaching? Accessed July 2009.

Australian Institute of Marine Science. 2008. Coral bleaching information index. Accessed July 2009.

NOVA: Coral Bleaching: Will Global Warming Kill the Reefs? Accessed July 2006.

ER IVA 22. What Are Zooxanthellae?

Background

Corals belong to the phylum Cnidaria, an exclusively aquatic division of animals that also includes anemones and jellies. This group is radially symmetrical (round) and hollow, with one body opening for the mouth. Surrounding the mouth are tentacles armed with tiny stinging capsules called nematocysts. All cnidarians are carnivores, and the tentacles and nematocysts are used to capture prey.

The body and tentacles consist of two cell layers that function as an inner and outer skin: the endoderm forms the lining of the gut and the ectoderm forms the outer covering. Between the two lies a noncellular substance called mesoglea, which is best developed in the jellies.

zooxanthellae

A light microscopy photo of zooxanthellae cells.
Photo Courtesy: Scott R. Santos, Dept. of Biological Sciences, Auburn University

Also characterizing this group is the presence of symbiotic organisms called zooxanthellae. Many cnidarians have zooxanthellae, but they are almost always present in anemones and corals. Zooxanthellae are tiny, one-celled plants classified as dinoflagellates. They characteristically have two hairlike structures called flagella. Like all plants, they convert nutrients into food using the sun’s energy. Because they need sunlight to survive, they are found in the skin or surface areas of their hosts. Zooxanthellae live in the tissues of a number of animals, including sea anemones, gorgonians (also known as sea fans), giant clams, and many nudibranchs (sea slugs). But they are best known for their relationships with corals.

It is this complex relationship that has captured scientists’ attention as they try to understand the process of bleaching. Bleaching and reef deterioration are widespread in the tropics. When reefs die, islands and their human inhabitants are left exposed to inundation by salt water during storms. This pressing issue requires the analysis of the bleaching process and focuses on the role that zooxanthellae play.

PDF file PDF file for this project

 

Focus Questions

What are zooxanthellae and where do they live?

notepad

objectives

Students will demonstrate an understanding of the shared characteristics of Cnidarians, i.e., presence of live zooxanthellae and nematocysts.

glass

materials

Anemones from a biological supplier
Microscopes or video microscopy setup
Slides and cover slips
Eye dropper
Vinegar

This activity works well using the giant green anemone found on the Oregon coast or the anemone Aiptasia sp., or green hydra, that are available through biological supply houses such as Carolina Biological Supply. Green anemones are difficult to collect and regulations apply to their collection.

clock

teaching-time

20 minutes

testtubes

procedure

1. Clip a small bit of tissue from the tip of the sea anemone tentacle. Place on a glass slide with a drop of water and cover with a coverslip.

2. Tap the cover slip until the tissues are crushed and release the zooxanthellae. Spread the body fluids of the anemone over the surface of the slide. Place under a microscope and look for round cells of the zooxanthellae.

3. Look for tiny rods in the tissues. These are unfired nematocysts (stinging cells common to cnidarians). In the Pacific giant green anemone, Anthopleura xanthogrammica, the zooxanthellae are tiny bright green orbs.

4. Clip another bit of tissue from the tip of the anemone tentacle and place on a glass slide and position a cover slip over the tissue. Place under the microscope and observe the tissue.

5. Drip several drops of vinegar onto the glass slide and watch as the acid seeps under the cover slip to the tentacle and the nematocysts are fired. Most of the tentacles will eject tiny hairs (the nematocysts). The tip is an especially good place to look. It will look like a bad hair day on the tentacle.

  student-work
questionmark

questions

1. What functions are performed by the nematocysts?

2. What animals with nematocysts are harmful to people?

3. What are zooxanthellae and why are they important to corals?

4. Why are scientists interested in investigating the relationship between corals and zooxanthellae?

  teacher-key
answermark

answers

1. What functions are performed by the nematocysts?

Protection, stunning prey for food.

2. What animals with nematocysts are harmful to people?

Box jellyfish of Australia can kill people; fire coral in the Caribbean can give skin divers a nasty rash; Portuguese man-of-war can give painful stings

3. What are zooxanthellae and why are they important to corals?

They are small, one-celled organisms with two tails that can produce food. The excess food zooxanthellae produce is an important food source for coral.

4. Why are scientists interested in investigating the relationship between corals and zooxanthellae?

Coral bleaching occurs when corals expel their symbiotic zooxanthellae. Many islands in tropical zones are dependent on coral reefs for protection against storm surges. Unlocking the mechanism of bleaching may provide clues to control it.

computer

references

Santos, S. and NOAA. Photos of zooxanthellae. Accessed July 2009.

ER IVA 23. Use of Bioinformatics to Identify Coral Zooxanthellae

Background

Understanding corals and their responses to environmental changes must involve investigation of their zooxanthellae. Little work has been conducted on these symbiotic organisms; we don’t even know how many different species there are. For many years it was thought that only one or two species of zooxanthellae occurred in the many species of corals. But with new molecular genetic techniques, coral biologists are discovering there are indeed many species of zooxanthellae, and each may react differently to the changes in environmental conditions.

PCR setup
A lab worker performs PCR at the Georgia Public Health Laboratory.
Image Courtesy: Centers for Disease Control and Prevention

The molecular biology techniques of the polymerase chain reaction (PCR) and DNA sequencing used in combination with powerful bioinformatics computer programs are helping coral biologists investigate the molecular basis for symbiosis and coral bleaching. Researchers studying coral health are asking whether some coral species are more sensitive to climate change and others are more resilient. In the resilient species, is this “fitness” due to differences among zooxanthellae species? Their hope is that identifying the dinoflagellates associated with different corals at the genetic level will help them begin to understand how the coral/zooxanthellae symbiosis is established and maintained or disrupted in response to an environmental stress.

This activity leads students through the process of using DNA sequences to identify and differentiate different species of coral zooxanthellae. Actual DNA sequences used in researchers’ laboratories in Hawaii are used in these student exercises. The introductory level activity takes students through the manual process of sequence comparison that was used in research labs when sequences first became available. Computer programs were later developed that can conduct sequence comparisons on a large number of sequences in a matter of a few seconds. Biotechnology research Web sites and BLAST searches are used in the second, more advanced, activity.

Part A. Manual Analysis Of Zooxanthellae Gene Sequences (Basic Activity)

Part B: Download PDF

PDF file PDF file for this project

 

Focus Questions

How can DNA mapping and comparing sequences advance knowledge of coral symbionts?

notepad

objectives

Students will understand how DNA sequences can be used to differentiate species.

glass

materials

Overhead transparencies or thin paper such as tracing paper.
Water-soluble markers for transparencies (pencils if tracing paper is used)
Rulers
Coral zooxanthellae sequences given below

clock

teaching-time

15 minutes

testtubes

procedure

1. Below are two short segments of actual coral zooxanthellae DNA sequence from Dr. Ruth Gates’ lab at the University of Hawaii. Based on a careful comparison of the two sequences, are these the same species or are they different but closely related? By looking at the sequence of nucleotides (adenine, cytosine, guanine, and thymine) scientists can determine if they are the same or different species and even identify the genes that produce proteins that may be heat sensitive. This research can help scientists understand coral bleaching.

Seq. #1: ATCGAATGCCTGATCCGAACATTGCAT

Seq. #2: ATCGAATGCGTGAACCGAACATTGCAT

2. Draw a vertical line through the two sequences where they are different.

3. The three base pair sequences on the student work sheets are larger, but the process to compare them is the same. One way to compare them is to print each sequence on thin paper or transparency. Overlay one sequence with another to be compared. Space is available between the lines so that one line of the first sequence will show above the same line of the second sequence. The mismatched letters can then be easily identified. These mismatched letters help scientists detect differences among zooxanthellae species. If the sequences match exactly, then they are from the same species. Examine and compare these three DNA maps and determine if they come from the same or different species.

  student-work
questionmark

questions

Sequences:

Zooxanthellae #C35

AACCAATGGCCTCCTGAACGTGCGTTGCACTCTTGGGATTTCCTGAGAGTATG

TCTGCTTCAGCGCTTAACTTGCCCCAACTTTGCAAGCATTTCTGCCTTGCGTTC

TTATGAGCTATTGCCTCTCTGAGCCAATGGCTTGTTAATTGCTTGGTTCTTGC

AAAATGCTTTGCGCGCTGTTATTCAAGTTTCTACCTTCGTGGTTTTACTTGAG

GACGCTGCTCATGCTTGCAACCGCTGGGATGCAGGTGCATGCCTCTAGCATG

AAGTCAGACAAGTGA

Zooxanthellae #C32:

AACCAATGGCCTCCTGAACGTGCGTTGCACTCTTGGGATTTCCTGAGAGTATG

TCTGCTTCAGCGCTTAACTTGCCCCAACTTTGCAAGCATTTCTGCCTTGCGTTT

TTATGAGCTATTGCCCTCTGAGCCAATGGCTTGTTAATTGCTTGGTTCTTGC

AAAATGCTTTGCGCGCTGTTATTCAAGTTTCTACCTTTGTGGTTTTACTTGAGT

GACGCTGCTCATGCTTGCGACCGCTGGGATGCAGGTGCATGCCTCTAGCATG

AAGTCAGACAAGTGA

Zooxanthellae #C15d:

AACCAATGGCCTCCTGAACGTGCCTTGCACCCTTGGGATTTCCTGAGAGTATG

TCTGCTTCAGTGCTTAACTTGCCCCAACTTTGCAAGCAGGATGTGTTTCTGCC

TTGCGTTCTTATGAGCTATTGACTTCTGCGCCAATGGCTTGTTAATTGCTTGGT

TCTTGCAAAATGCTTTGCGCACTGTTATTCAAGTTTCTACCTTCGCGGTTTTAC

TTGAGTGACGCTGCTCATGCTTGCAACCGCTGGGATGCAGGTGCATGCCTCTA

GCATGAAGTCAGACAAGTGA

1. How many differences are there in the two short sequences you compared in the first part of the exercise? Are the two sequences from the same species of zooxanthellae?”

2. Are the three sequences you used in the second part of the activity the full DNA genome of zooxanthellae?

3. Are the three sequences from the same species of zooxanthellae? How do you know?

4. What can scientists learn from the differences in the DNA sequences?

5. How could comparison of these sequences be made easier? What if the sequences were much longer? What if you were trying to compare a much larger number of sequences?

  teacher-key
answermark

answers

1. How many differences are there in the two short sequences you compared in the first part of the exercise? Are the two sequences from the same species of zooxanthellae?”

Two differences; No, if the two species were identical the two gene sequences would have been identical.

2. Are the three sequences you used in the second part of the activity the full DNA genome of zooxanthellae?

No, the sequence is from a gene common to all zooxanthellae. The complete genome would be much, much longer.


3. Are the three sequences from the same species of zooxanthellae? How do you know?

C15d is different. C35 and C32 are the same species, as their two sequences are exactly the same.


4. What can scientists learn from the differences in the DNA sequences?

The differences indicate that the zooxanthellae may belong to a different clade (very closely related species with differences that are too minimal to justify designating a new species) of zooxanthellae. The difference may provide some clue as to whether those zooxanthellae species are more resistant to heat and less prone to bleaching.


5. How could comparison of these sequences be made easier? What if the sequences were much longer? What if you were trying to compare a much larger number of sequences?

Computer technology can be used to more quickly, easily, and accurately compare sequences. This technology is especially useful if longer or more sequences are being compared.

computer

references

Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, DJ Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nuc Acids Res 25:3389-3402.

ClustalW, WWW Service at the European Bioinformatics Institute

Higgens D, Thompson J, Gibson T, Thompson JD, Higgens DG, Gibson TJ. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignments through sequence weighting position-specific gap penalties and weight matrix choice. Nuc Acids Res 22:4673-4680.

Rodrigo Lopez, Services Programme and Andrew Lloyd. The ClustalWWW server at the EBI. embnet.news. Volume 4. 1997.  http://www.embnet.org/files/shared/EMBnetNews/embnet_news_4_3.pdf. Acessed July 2009.

ER IVB 24. Microbial Identification: Reading Genetic Name Tags with PCR and Sequencing Student Reading

Background

The vast biodiversity of the oceans resides not in the vertebrate or invertebrate organisms, but rather in the microbial species found in the water, on the surfaces of other organisms, and in the sediments on the ocean floor. Many of these organisms live as symbionts, inhabiting the tissues of invertebrates such as sponges and coral. Others, known as extremophiles, live in harsh environments, thriving under conditions of extreme (high and low) temperature, salinity, pH, pressure, radiation, or concentrations of toxic compounds (Maloney 2004). Scientists are gaining a new appreciation for the important roles marine microbes play in energy production, nutrient cycling, global climate modulation, and chemical production.

If you could peer into one milliliter of ocean water under a microscope and count the organisms present, you would find an amazing variety of microbial life, including bacteria and fungi. Over 1 million bacterial cells and huge populations of viruses are present in each milliliter of sea water. While some of these cells belong to identified and characterized microbial species, the vast majority represent new species.

To date less than 1 percent of the marine bacteria have been cultured. Through recent advances in sequencing, genomic studies, and the polymerase chain reaction (PCR), scientists have gained access to the genetic information of the microbial population in a seawater sample without needing to culture the bacteria. These tiny organisms hold a treasure chest of novel chemical molecules which scientists are finding promising as drugs, nutritional supplements, cosmetic ingredients, and industrial enzymes.

Potential Uses of Marine Bacteria

Most people have a negative image of bacteria, associating them with disease, deadly infections, and antibiotic resistance. But the ocean’s microbial communities are critical to the health of our oceans and our planet, modulating nutrient recycling, orchestrating changes in the global climate, and generating energy.

Scientists recently discovered Sar11, a new, extremely small bacterial species that is distributed across the world’s oceans in great abundance (Morris et al. 2002). Before it was identified, Sar11 fell into the class of the “unculturables,” bacteria that did not grow under the traditional, nutrient-rich conditions microbiologists provided in the lab. By comparing plate counts (the number of bacterial colonies growing on marine agar plates) with direct counts (the number of bacteria visible under a microscope after staining for DNA), scientists knew that most of the marine microbes in seawater samples had not been successfully cultured.

Aided by biotechnology, Dr. Steve Giovannoni of Oregon State University and his colleagues were able to identify Sar11 using PCR and DNA sequencing to read Sar11’s genetic name tag—the sequence of Sar11’s 16S rRNA gene (Giovannoni et al. 1990). Universally conserved among all cellular forms of life (including Eukarya, Archae, Bacteria), the 16S rRNA gene sequence of an organism can serve as a name tag or a barcode to identify that organism and distinguish it from other forms of life (Pace et al. 1986). Several features of the 16S rRNA gene make it an ideal name tag. The 16S rRNA gene has regions that are highly conserved and regions that are highly variable; it has a conserved secondary structure that is useful in detecting PCR and sequencing artifacts; and with very few exceptions, the gene is not transferred laterally from one organism to another.

These researchers sidestepped the need to culture the bacteria by using PCR to make a library containing copies of all of the different 16S rRNA genes present in the individual microbes in a seawater sample.

By sequencing the different 16S rRNA genes present in the library of seawater DNA and analyzing the results, scientists have been able to identify the species of bacterioplankton that were present in the sample. Many represent entirely new species and even taxa. Following its identification in the Sargasso Sea, Sar11 has since been found to be a dominant surface bacterioplankton, abundant throughout the global ocean. It is estimated that Sar11 represents 24 percent of all the prokaryotes in the ocean and that the biomass of Sar11 is greater than the biomass of all of the fish in the ocean, making Sar11 a major success story in microbial evolution (Morris et al. 2002). Another reason for excitement at this discovery is that Sar11 captures sunlight and manufactures its food without the use of chlorophyll.

PDF file PDF file for this project

  Focus Questions
notepad objectives
glass materials
clock teaching-time
testtubes procedure
  student-work
questionmark

questions

Microbial Identification: Reading Genetic Name Tags with PCR and Sequencing
Student Work Sheet

1. Why are the oceans of such interest to microbiologists?

2. Why was the discovery of SAR 11 so exciting?

3. Why was the 16S rRNA gene important in Sar11’s identification?

  teacher-key
answermark

answers

Microbial Identification: Reading Genetic Name Tags with PCR and Sequencing

1. Why are the oceans of such interest to microbiologists?

They are a vast source of undiscovered microbes.

2. Why was the discovery of SAR 11 so exciting?

• It is so tiny that it was could not be cultured with traditional methods.
• It was the application of biotechnology techniques that opened up a new approach to studying marine microbes.
• The abundance of this microbe is amazing in that it is estimated to equal the biomass of all the fish in the oceans.
• It is unique in that it can manufacture its food without the use of chlorophyll.

3. Why was the 16S rRNA gene important in Sar11’s identification?

This gene is present (conserved) in many organisms and can be used to identify new species as well as the study of other biological processes.

computer

references

Giovanonni , S. J., T.B. Britschgi, C.L. Moyer, and K.G. Field. 1990. Genetic diversity in Sargasso Sea bacterioplankton. Nature 345: 60–63.

Morris, R.M., M.S. Rappe, S.A. Connon, K.L. Vergin, W.S. Siebold, C.A. Carlson, and S.J. Giovannoni. 2002. SAR11 clade dominates ocean surface bacterioplankton communities. Nature 420: 806–809.

Pace, N.R., D.A. Stahl, D.J. Lane, and G.J. Olsen. 1986. The analysis of natural microbial populations by ribosomal RNA sequences. Adv. Microbial Ecol. 9:1–55.

Rappe, M.S., S.A. Connon, K.L. Vergin, and S.J. Giovannoni. 2002. Cultivation of the ubiquitous SAR11 marine bacterioplankton clade. Nature 418: 630–633.

ER IVB 25. Isolating Bacteria from Seawater

Background

Marine bacteria are of special interest to scientists, as they are often the source of new compounds of interest to the pharmaceutical industry and may be the source of other new products. Bacteria also play an important role in ocean ecosystems. This activity explores some of the ways that bacteria are sampled and studied.

Although many ocean microbes are not readily cultured, the opportunity for students to isolate a new organism in this activity is an exciting motivator for exploring marine biodiversity. You can investigate the diversity of marine bacteria by either directly culturing seawater samples or carefully sampling sponges (IIC 6. Isolating Bacteria from Sponges (IIC6) in this curriculum).

PDF file PDF file for this project

 

Focus Questions

How can the large diversity of bacterial fauna in seawater be sampled and studied?

notepad

objectives

Students will

• Describe the new molecular, genetic, and culturing techniques marine microbiologists are using to explore the microbial communities of marine ecosystems

• Learn about techniques that are being used to circumvent the difficulties of culturing marine microbes

glass

materials

Salinometer

Student work sheet (in this activity file)

IVB24. Microbial Identification: Reading Genetic Name Tags with PCR and Sequencing (IVB24)

(Reading in this curriculum)

Internet access for literature search (extension activity)

Bacterial Isolation

Sterile 15 ml plastic tubes with screw tops
Marine agar plates prepared using
Difco Marine Agar MA2216 or Marine Bacterial Media from BD
Biosciences Product (Catalogue # 212185)
Sterile glass spreaders or other sterile plastic spreader

Gram Staining and Microscopy

Clean microscope slides
Crystal violet staining solution
Iodine 95% ethanol
Distilled water
Safranin
Microscope with 100x oil immersion lens or most powerful lens available to class

Freeze Cultures

DMSO
Sterile screw cap 1 or 2 ml tubes appropriate for freezing
-20°C or -80°C freezer
Sterile marine broth medium

clock

teaching-time

Two to three class periods. Cultures require up to 72 hours to grow.

testtubes

procedure

Bacterial Isolation

1. Collect a 10 ml sample of seawater from an environment of interest in one of the 15 ml tubes. Establish a collection log, documenting the site of collection, the date, the ambient water temperature, the salinity, and a description of the sample environment. From this sample you will culture bacteria on marine agar plates and examine individual colonies taken from the plates.

2. Label marine agar plates/LB plates with your name, date, and collection sample number.

3. Inoculate each plate with 100 µl of the seawater sample by pipetting 100 µl onto the plate.

4. Quickly spread the sample evenly over the agar using a sterile plate spreader. Use the lid to shield from airborne bacteria and turn the plates continually for at least 30 seconds to achieve an even spread.

5. Incubate the plates at the ambient temperature of the original sample. The plates should be inverted with the agar side on top to prevent condensation problems. Incubate the plates, examining them for colonies after 24, 48, and 72 hours. Many marine bacteria grow slowly.

6. Document in your collection log the bacterial colonies on your plate. Determine how many different colony types are on the plate. Note the color, shape, size, and abundance of each colony type. Give each colony a collection number using your initials, date, location code and sample number. The entire class should use the same numbering system. For example, KVZ032405TBr1c1 might correspond to a sample collected by Kari van Zee on March 4, 2005, at Turtle Beach region 1, and the colony is colony 1.

7. Streak each of the colonies you choose for further analysis on fresh marine agar plates to isolate single colonies. Incubate the plates 24 to 72 hours at the proper temperature. Seal plates with parafilm and store at 4°C.

Note: Be sure to handle these cultures carefully, treating them as human pathogens.

Avoid contact with the samples. Wash hands thoroughly and sterilize all materials that have come in contact with the cultures before disposing of them either by autoclaving the samples or immersing them in a 10 percent bleach solution for at least 1 hour.WP

Gram Stain and Light Microscopy

Although not definitive for species identification, analyzing bacterial samples at the macroscopic (colony) and microscopic (type) level provides useful data for students to strengthen their critical thinking skills. Comparison of colony morphologies such as color, shape, effect on agar, and comparison of bacterial characteristics elucidated from staining also allows students to study and appreciate marine microbial biodiversity if molecular equipment is not readily available.

1. Using a few cells from the colonies you mark, prepare smears on clean microscope slides.

2. Air dry and heat fix the smears.

3. Immerse each slide in a solution of crystal violet stain for 1 minute, rinse with distilled water, and drain.

4. Immerse each slide in iodine for 1 minute, rinse, and blot dry.

5. Immerse in 95 percent ethanol for 15 seconds to destain then rinse with distilled water and drain.

6. Counterstain with safranin for 20 to 30 seconds, rinse, and blot dry. Examine under the microscope. Note the morphology of the bacteria: are they rods, cocci, or other shapes? Are the bacteria stained with the Gram stain? Do the cells form filaments or clusters? How large are the cells?

Freeze Cultures (Storing Cultures for Later Study)

1. Choose the culture you find most interesting. Prepare an overnight culture (2 ml) of this strain in sterile marine broth medium.

2. Label a sterile screw-cap tube with your name, date, and collection number for the culture you are freezing.

3. Add 0.2 ml of dimethyl sulfoxide (DMSO) to the tube and add 1 ml of an overnight liquid bacterial culture (save the remaining culture to prepare genomic DNA).

4. Shake gently to mix and freeze at -80°C. The cultures will remain viable indefinitely at -80°C.

5. To start a fresh culture from a frozen stock, scrape a small chunk of the frozen culture and transfer to a sterile tube containing 3 ml of marine broth. Do not allow the frozen culture to thaw. Return the frozen culture to the freezer immediately. If you do not have access to a -80°C freezer, prepare frozen cultures and store at -20°C.

  student-work
questionmark

questions

1. Why are microbes important in the marine environment? What roles do they play?

2. What techniques do scientists use to identify bacteria at the molecular level?

3. Have many of the marine microbes been successfully cultured? Why?

4. Describe the results of your bacterial plating experiment. Where did you collect your samples?

5. Do you think you cultured all of the different types of bacteria present in your seawater sample? How could you determine what percentage of bacteria in your seawater sample were successfully cultured?

6. Describe the morphology of the colony you chose for Gram staining. What were the results of the Gram staining?

7. What is Sar11 and why is it important in the marine environment?

  teacher-key
answermark

answers

1. Why are microbes important in the marine environment? What roles do they play?

Marine microbes play important roles in energy production, nutrient cycling, global climate modulation, and chemical production.


2. What techniques do scientists use to identify bacteria at the molecular level?

Scientists can use PCR and DNA sequencing to identify bacteria.


3. Have many of the marine microbes been successfully cultured? Why?

No. Many marine bacteria fall into the class of “unculturables,” bacteria which do not grow under the traditional, nutrient-rich conditions microbiologists provide in the lab. The marine environment typically has very low levels of nutrient.

4. Describe the results of your bacterial plating experiment. Where did you collect your samples?

Answers will vary.


5. Do you think you cultured all of the different types of bacteria present in your seawater sample? How could you determine what percentage of bacteria in your seawater sample were successfully cultured?

No. You could determine the percentage of bacteria successfully cultured by comparing plate counts (the number of bacterial colonies growing on marine agar plates) with direct counts (the number of bacteria visible under a microscope after staining for DNA).


6.Describe the morphology of the colony you chose for Gram staining. What were the results of the Gram staining?

Answers will vary.


7. What is Sar11 and why is it important in the marine environment?

Sar11 is an extremely small bacterial species that is distributed throughout the world’s oceans in great abundance. Following its identification in the Sargasso Sea, Sar11 has been found to be a dominant surface bacterioplankton, abundant throughout the global ocean. It is estimated that Sar11 represents 24 percent of all the prokaryotes in the ocean and that the biomass of Sar11 is greater than the biomass of all of the fish in the ocean.

Extension Activities

1. Molecular identification of the isolated bacterial colonies using PCR and DNA sequencing could be an exciting independent project for an advanced student to pursue. Because this project requires equipment and chemicals not readily available in the high school science lab, students are encouraged to find a science mentor at a research university or institute who is working in the field of molecular marine biology, pharmacology, or microbiology. Many scientists welcome high school interns in their laboratories.

Before meeting with the scientist, a student should have a good understanding of the following concepts:

• DNA structure

• Polymerase chain reaction (V.33. The Polymerase Chain Reaction (PCR): A Scientific Revolution Comes to Marine Biology) (V#33)

• DNA sequencing

• Universally conserved genes and how they can serve as a genetic name tag or barcode (IVB24 Microbial Identification: Reading Genetic Name Tags with PCR and Sequencing (IVB24) in this curriculum)

2. If such a collaboration is not possible, encourage students to read scientific papers written by scientists in this field to learn how scientists study marine microorganisms. Students can access many scientific papers through PubMed (see IIIE16 The NCBI PubMed: Accessing Scientific Publications (IIIE16) in this curriculum). Students may want to begin by looking into the work of scientists Dr. Mike Rappé, Hawaii Institute of Marine Biology, University of Hawaii; and Dr. Stephen Giovanonni, Oregon State University. Students should gain a good understanding of the concepts listed above.

computer

references

Delong, E.F. 2005. Microbial community genomics in the ocean. Nature Reviews, Microbiology. 3:459–469. Accessed on December 12, 2005 at

Giovanonni , S. J., T.B. Britschgi, C.L. Moyer, and K.G. Field. 1990. Genetic diversity in Sargasso Sea bacterioplankton. Nature 345: 60-63.

Maloney, S. 2004 Accessed August 2005.

Morris, R.M., M.S. Rappe, S.A. Connon, K.L. Vergin, W.S. Siebold, C.A. Carlson, and S.J. Giovannoni. 2002. SAR11 clade dominates ocean surface bacterioplankton communities. Nature 420: 806–809.

Pace, N.R., D.A. Stahl, D.J. Lane, and G.J. Olsen. 1986. The analysis of natural microbial populations by ribosomal RNA sequences. Adv. Microbial Ecol. 9:1–55.

Rappe, M.S., S.A. Connon, K.L. Vergin, and S.J. Giovannoni. 2002. Cultivation of the ubiquitous SAR11 marine bacterioplankton clade. Nature 418: 630–633.

ER IVB 26. Identifying E. coli in Local Water Samples

Background
E. coli
An image of E. coli taken with an Atomic Force Microscope (AFM).
Image Courtesy: Dee Hartrung, Arizona State University School of Life Sciences

Escherichia coli is a member of the family of bacteria Enterobacteriaceae, which is informally referred to as the enteric bacteria. Other enteric bacteria are the large Salmonella bacteria families, Klebsiella pneumoniae, and Shigella, which many researchers consider to be part of the E. coli family.

Coliform bacteria are commonly found in the intestinal tracks of warm-blooded animals. E. coli was discovered in the human colon in 1885 by German bacteriologist Theodor Escherich. Dr. Escherich also showed that certain strains of the bacteria were responsible for infant diarrhea and gastroenteritis—an important public health discovery.

Although the vast majority of E. coli strains are harmless, including those commonly used by scientists in genetics laboratories, fecal pollution is a leading cause of global enteric waterborne diseases. According to the World Health Organization, more than 2 million children die annually from these diseases. In the United States alone, the Centers for Disease Control and Prevention estimates that 73,000 cases of infection with Escherichia coli O157:H7 occur every year and 2,100 people are hospitalized and 61 people die as a direct result of E. coli infections and complications that can result from infections.

Fecal coliform is considered an indicator organism, meaning that its presence suggests that more serious bacterial pollution is present. Although they are abundant, fecal coliform bacteria themselves are usually harmless, but they originate from the same sources as the pathogens that cause disease. The presence of coliforms indicates that fecal contamination has occurred. Consumption or recreational contact with contaminated water can cause a variety of illnesses, from gastrointestinal discomfort, a minor sickness to most people, to more severe waterborne diseases such as cholera.

Monitoring for indicator organisms is usually much easier and more cost effective than monitoring for the actual disease-causing organisms. Pathogens typically occur in very small concentrations, so routinely monitoring for pathogens is analogous to looking for a needle in a haystack. Field sampling and laboratory methods for measuring pathogens are very time consuming and expensive, and sometimes they put the analyst at more risk of being infected by the pathogen. Separate tests must be performed for each individual pathogen, which is expensive.

Scientists use a variety of methods to monitor water contamination, including culturing tests. To model culturing tests, this activity uses 3M PetrifilmTM EC plates, a ready-to-use sample system containing Violet Red Bile, a cold-water gelling agent, an indicator for glucuronidase activity, and another indicator to facilitate colony enumeration. These plates are used for the enumeration of E. coli and other coliforms in the food and beverage industry. Although they are not intended for testing water samples, the plates work well for various seawater samples as described in this classroom activity.

The 3M PetrifilmTM does not distinguish between E. coli strains. Like most other E. coli coliform media, these plates do not specifically indicate whether any O157 strain is present. E. coli is atypical in that it is glucuronidase negative and will not produce a blue color indicated by the Petrifilm EC plates. Of course, after use the plates may be a potential biohazard and must be disposed of correctly (put plates in pressure cooker for 10 minutes at 10 pounds pressure to sterilize or submerge in 10 percent bleach solution for at least one hour).

PDF file PDF file for this project

 

Focus Questions

Can E. coli be found in water samples taken from local water bodies?

notepad

objectives

Students will:

• Culture bacteria on coliform media

• Count and compare E. coli and other coliform colonies cultured from different sources

glass

materials

3M PetrifilmTM E. coli/coliform count plate
Can be ordered from Science Kit Boreal
777 E. Park Drive, P.O. Box 5003, Tonawanda, NY 14150.
Phone: 800-828-7777.
http://sciencekit.com/Default.asp?bhcd2=1248800360
#WW7700004—package of 25 for $63.35

Water samples
Sterile collection tubes
Spreaders—sterile glass or plastic spreaders
Pipettes
Incubator
Pressure cooker or bleach for treatment of biohazard materials before disposal
Standard colony counter or illuminated magnifier
Rubber gloves

clock

teaching-time

Two days (culture requires 24 hours of incubation time at 35oC)

testtubes

procedure

Sampling

1. Wearing rubber gloves, collect water samples from a local water body (NOT tap water!) in sterile tubes (only 1 ml is needed for test).

2. Record location, time, and other relevant environmental factors.

Plating

1. Wear rubber gloves for the duration of this activity

2. Place Petrifilm EC plate on a flat surface.

3. Lift top of film. Holding pipette perpendicular to the plate, dispense 1 ml of sample onto the center of the bottom film.

4. Roll the top film down to prevent trapping air bubbles.

5. Place the spreader over the center of the plate and press gently.

6. Remove the spreader and leave the plate undisturbed for at least one minute to permit the gel to form.

7. Incubate for 24 hours at 37 + 1oC.

8. After incubation, count using a standard colony counter or illuminated magnifier.

9. Wash hands thoroughly with soap after handling samples and plates.

The interpretation of the plate results are as follows. Blue and red colonies associated with entrapped gas, regardless of size, are confirmed E. coli. Blue colonies without trapped gas are not E. coli. Other coliform colonies are red and associated with entrapped gas within one colony diameter. If the entrapped gas bubble is farther than a colony diameter away, the colony it is not counted as coliform. The total coliform count consists of both red and blue colonies associated with gas.

  student-work
questionmark

questions

1. Where are coliform bacteria typically found?

2. What is an indicator organism? Is fecal coliform an indicator organism?

3. Why do water-quality specialists monitor for indicator organisms?

4. Describe the plate-culturing test used in this experiment. What is in the plates?

5. Why is it important to distinguish between cattle and human coliform bacteria?

6. Does this test distinguish between different E. coli strains? How could you distinguish between different strains?

  teacher-key
answermark

answers

1. Where are coliform bacteria typically found?

Coliform bacteria are commonly found in the intestinal tracts of warm-blooded animals.

2. What is an indicator organism? Is fecal coliform an indicator organism?

An indicator organism is one whose presence or status suggests something about the state of the environment. Fecal coliform is an indicator species whose presence indicates that fecal contamination has occurred and more serious pathogenic organisms may be present in a water body.

3. Why do water-quality specialists monitor for indicator organisms?

It is often faster and more cost effective to monitor for indicator organisms than for the actual disease-causing organism. Separate tests must be performed for each pathogen. Also, pathogens typically are found in low concentrations.

4. Describe the plate-culturing test used in this experiment.

What is in the plates?3M PetrifilmTM EC plates are a ready-to-use sample system containing Violet Red Bile, a cold-water gelling agent, an indicator for glucoronidase activity, and another indicator to facilitate colony enumeration.

5. Why is it important to distinguish between cattle and human coliform bacteria?

Some human coliform bacteria cause diseases or indicate that other disease organisms are present, whereas cattle coliforms are harmless to humans. Both coliforms are frequently found in rivers and coastal waters.

6. Does this test distinguish between different E. coli strains? How could you distinguish between different strains?

No, this test does not distinguish between different E. coli strains. PCR could be used to distinguish different strains.

computer

references

Environmental Protection Agency, Ground Water and Drinking Water. Accessed July 2009.

ER IVB 27. PCR-Based Testing for Fecal Pollution

Backgroud

Coliform bacteria are commonly found in the intestinal tracks of warm-blooded animals. Although the vast majority of Escherichia coli strains are harmless, including those commonly used by scientists in genetics laboratories, fecal pollution is a leading cause of global enteric waterborne diseases. According to the World Health Organization, more than 2 million children die annually from these diseases. In the United States alone, the Centers for Disease Control and Prevention estimates that 73,000 cases of Escherichia coli O157:H7 infection occur every year. Of these, 2,100 people are hospitalized and 61 people die as a direct result of E. coli infections and related complications. Fecal coliform is considered an indicator organism, meaning that its presence suggests that more serious bacterial pollution is present. Although they are abundant, fecal coliform bacteria themselves are usually harmless, but they originate from the same sources as the pathogens that cause disease.

Elevated levels of fecal coliform bacteria are often found in rivers, lakes, and coastal waters. This contamination can come from humans, dogs, cats, and cows, as well as wildlife such as geese, deer, and beavers. The pathways these bacteria take to get into streams and rivers are varied and depend on which sources contribute pathogen loads and the runoff conditions. Fecal coliform bacteria from cattle might be washed into a stream from a pasture during rainfall, geese and ducks might defecate directly into a stream or river while feeding, and bacteria from human sources may enter the water as a result of sewage spills, leaking sewer lines, or malfunctioning septic systems.

Monitoring for indicator organisms is usually much easier and more cost effective than monitoring for the actual disease-causing organisms. Pathogens typically occur in very small concentrations, so routinely monitoring for pathogens is analogous to looking for a needle in a haystack. Field sampling and laboratory methods for measuring pathogens are very time consuming and expensive and sometimes put the analyst at more risk of being infected by the pathogen. Separate tests must be performed for each individual pathogen, which is expensive. A reliable test is needed to distinguish between human fecal coliform, which can cause diseases, and animal fecal coliform, which is harmless. Diagnostic tests based on the polymerase chain reaction (PCR) offer a reliable solution to this problem. To learn how PCR works, read The Polymerase Chain Reaction (PCR): A Scientific Revolution Comes to Marine Biology (V33) and The PCR Dash: A Classroom Game (V34)

PDF file PDF file for this project

 

Focus Questions

How can water pollution due to sewage contamination be identified using PCR?

notepad

objectives

Students will learn how the polymerase chain reaction can be used in a reliable test to identify pathogens in the environment.

glass

materials

PCR-Based Water Quality Test Kit (#952 for 10 groups, $85) available from EDVOTEK, P.O. Box 341232, Bethesda, MD 20827, Phone: 1-800-388-6835, www.Edvotek.com

Thermocycler
Thin-walled 0.2 ml PCR tubes
Water bath
Micropipettors and disposable tips
Agarose gel electrophoresis equipment
Power supplies
UV light for viewing agarose gels
UV-safety eye goggles
Bleach

clock

teaching-time

DNA extraction/preparation 45 minutes
PCR 2 hours or overnight
Electrophoresis (125 v) 60–75 minutes
Staining and analysis 20 minutes

testtubes

procedure

All procedures are outlined in the kit. The kit provides the chemicals and procedures needed to extract bacterial DNA from a sample of water and amplify E. coli DNA sequences using PCR. PCR is described in detail in other activities in this curriculum (The Polymerase Chain Reaction (PCR): A Scientific Revolution Comes to Marine Biology (V33) and The PCR Dash: A Classroom Game (IIID13), and animations of PCR can be found at http://www.dnalc.org/ddnalc/resources/pcr.html and http://library.thinkquest.org/24355/data/details/media/polymeraseanim.html.

Water samples should be considered biohazards and treated by the addition of bleach to 10% for 1 hour before disposal. Similarly, DNA samples, any disposable tips, and tubes used in the experiment should be immersed in 10% bleach prior to disposal. Students should wash hands and lab benches thoroughly after working with samples.

  student-work
questionmark

questions

1. Where are coliform bacteria typically found?

2. What is an indicator organism? Is fecal coliform an indicator organism?

3. Why do water-quality specialists monitor for indicator organisms?

4. Does this test distinguish between different E .coli strains? How could you distinguish between different strains?5. What groups of people can benefit from a quick, accurate identification of the source of E. coli in water bodies?

6. Describe how PCR works.

7. From which organism was Taq polymerase isolated? Why is this enzyme essential to PCR?

8. What are the advantages of using a PCR-based diagnostic test??

  teacher-key
answermark

answers

1. Where are coliform bacteria typically found?

Coliform bacteria are commonly found in the intestinal tracts of warm-blooded animals.

2. What is an indicator organism? Is fecal coliform an indicator organism?

An indicator organism is one whose presence suggests that more serious bacterial pollution is present. Yes, the presence of coliform bacteria suggests fecal contamination has occurred and more serious pathogen bacteria may be present in a water source.

3. Why do water-quality specialists monitor for indicator organisms?

It is often faster and more cost effective to monitor for indicator organisms than the actual disease-causing organism. Separate tests must be performed for each pathogen. Also, pathogens typically are found in low concentrations.

4. Does this test distinguish between different E. coli strains?
How could you distinguish between different strains?

No, this test does not distinguish between different E. coli strains. PCR could be used to distinguish different strains. Species-specific primer pairs could be designed, or the PCR products could be sequenced to distinguish between strains.

5. What groups of people can benefit from a quick, accurate identification of the source of E. coli in water bodies?

Oyster growers, swimmers and surfers, people who rely on rural water supplies for drinking water.

6. Describe how PCR works.

PCR works as a “molecular photocopier” for the genetic material of all organisms. Using the natural function of a DNA-copying enzyme known as polymerase, PCR can be used to generate unlimited copies of any specified fragment of DNA. A PCR amplification reaction requires template DNA containing the sequence of interest (as few as one copy), two unique single-stranded DNA primers that bracket the desired sequence, deoxyribonucleotides (the building blocks of DNA), and Taq DNA polymerase (a heat-stable enzyme that builds DNA strands). The three phases of the reaction take place at three different temperatures that facilitate the synthesis of new copies of the desired DNA sequence. At 95°C, the double-stranded source (or template) DNA is denatured into single strands. Then, at 55°C, the primers bind (anneal) to complimentary sequences on the template DNA that bracket the sequence to be amplified. Last, at 72°C, the TaqDNA polymerase adds deoxyribonucleotides in sequence to the primer as it builds a complementary strand to the template DNA. This cycle is repeated until a very large number of copies are obtained. The reaction is usually carried out in a machine called a thermal cycler that quickly changes the temperature of the reaction mixture among the three necessary temperatures.

7. From which organism was Taq polymerase isolated? Why is this enzyme essential to PCR?

Taq polymerase was isolated from the bacterium Thermus aquaticus, growing in a hot spring at Yellowstone National Park. This enzyme does not denature at high temperatures and remains active through the denaturation step of the PCR cycle.

8. What are the advantages of using a PCR-based diagnostic test?

PCR is reliable, fast, cost-effective, very sensitive, and very specific. Tests results are available much faster than culturing methods. Low concentrations of pathogens can be detected using PCR. Also, it is easy to screen for multiple pathogens at the same time, even in the same PCR reaction, by combining primer pairs.

computer

references

Field, K. 2002. Molecular detection of anaerobic bacteria as indicator species for fecal pollution in water. U.S. Environmental Protection Agency National Center for Environmental Research. Accessed December 2004.

Field, K., T. J. Brodeur, L. K. Dick, M. Simonich, T. E. Jones Jr., C. Bracken, C. and A. E. Bernhard. 2002. Who’s Responsible: Fecal Source Tracking with Bacteroides. Research & Extension Regional Water Quality Conference.

Kreader, C. A. 1995. Design and evaluation of Bacteroides DNA probes for the specific detection of human fecal pollution. Applied and Environmental Microbiology, 61(4), pp. 1171–1179.

Kreader, C. A. 1995. Design and evaluation of Bacteroides DNA probes for the specific detection of human fecal pollution. Applied and Environmental Microbiology, 61(4), pp. 1171–1179.

University of Utah. The Wittwer Lab for DNA Analysis. External links to PCR animated tutorials and video lectures. Accessed July 2009.

ER IVB 28. Searching for Oil-Digesting Bacteria

Background

Bioremediation is the use of naturally occurring organisms to solve various environmental problems. Bioremediation may also be achieved by transferring genes from one organism to enhance the bioremediation capability of another. One example of bioremediation is the use of some types of plants to remove toxic materials from the environment. Areas that are high in arsenic, lead, or other contaminants can be cleaned naturally using selected plants, which take up the contaminants and store them in their foliage. The foliage is then disposed of safely. About 400 species of plants have been identified that are capable of extracting toxic chemicals from the soil. For example, a species of fern from the southeast United States that has been found to remove arsenic from the soil is now sold commercially. Other plants, such as one species of mustard, have been enhanced with genes from Escherichia coli bacteria to improve their ability to extract arsenic and other toxic materials directly from contaminated soils. Using these naturally occurring organisms to remove contaminants is often less damaging to the environment than mechanical means and less costly than other methods.

“Oil-eating” bacteria generate high levels of interest from both economic and scientific perspectives. Accidental oil spills and residue contamination from petroleum processing are fairly common. The oil industry in the United States uses about eight barrels of water to process one barrel of crude oil into gasoline. Wastewater from this process is contaminated with hydrocarbons from the oil. Disposal and cleanup of the contaminated water is a costly issue for oil refineries. Bacteria that consume petroleum compounds are being investigated as a low-cost solution to the problem. At current test sites, lagoons are filled with contaminated water inoculated with the oil-eating bacteria. However, the process of converting the oil and other hydrocarbons into smaller compounds is a slow one and is sensitive to environmental conditions. To improve efficiency, researchers are designing oil digesters that consist of cylinders filled with filter materials and inoculated with a large supply of oil-eating bacteria. These cylinders can be maintained at constant temperature, pH, and salinity, factors that are conducive to bacterial growth. As the oil-contaminated water is flushed through the filter, the bacteria break down oil into carbon dioxide and water. The invention of the digesters has been an engineering breakthrough in the field of bioremediation, as they are much faster and more efficient than the lagoon method. In addition, they confine the area that has been exposed to the soil bacteria populations. Other species of bacteria have been identified that can digest MTBE (methyl tertiary butyl ether), a new fuel additive to help gas burn more completely and reduce emissions; it has been found in the drinking water of Southern California

Biotechnology Application
Oil spills are sometimes very extensive and quite difficult to clean up. Because oil-eating bacteria occur naturally in the environment, stimulating the growth of what is already present makes more environmental sense than adding alien bacteria that might not be suited for the particular environment in which the spill occurred. Studies have shown that the best results for effective remediation of oil spills have been achieved by isolating populations of local bacteria from the contaminated area and culturing them, or growing them in large amounts in a laboratory or at a field site. The bacterial cultures are then combined with a high concentration of appropriate nutrients and re-dispersed at the contaminated site. The nutrients help ensure that the cultured bacteria thrive and multiply in the spill area. Once the cultured bacteria have been identified (by DNA sequence analysis) they are “cloned,” or propagated, to create large quantities of the species. Environmental engineers can use the successful bacterial population in new field tests to study requirements for its growth in digesters and to study its potential use in treating oil spills in different environments.

Oregon State University scientist Dr. Morrie Craig has discovered that baleen whales harbor microbes that can break down oil into short, chained hydrocarbons, “fatty acids” that can be digested. He has found that whales utilize the shorter carbon chains much as people utilize sugar for energy. The useful whale bacteria are anaerobic microbes, that is, they survive without oxygen. Craig suggests that these microbes can be cultured and distributed to oil spill areas but they would be effective only in anaerobic muds and other locations lacking oxygen. The technique is possible but there are significant drawbacks. Using gene transfer techniques to transfer the microbe’s ability to digest oil to other bacteria is more expensive than culturing the oil-digesting bacteria already present in most environments.

PDF file PDF file for this project

 

Focus Questions

Are oil-eating bacteria found in your local area?

notepad

objectives

Students will use an inquiry study to test for the presence of oil-digesting bacteria.

glass

materials

Introductory reading material (see above)
Ammonium phosphate (0.5 gram)
Magnesium sulfate (0.1 gram)
Potassium phosphate (0.5 gram)
Non-iodinated sodium chloride (non-iodinated table salt) (2.5 grams)
Lightweight machine oil (8 grams)
Distilled water (600 milliliters)
Soil (10 grams)
Beakers or glass jars (4 x 500 milliliters)
Aquarium pumps (1–2)
Four tubes to attach to the pumps
Splitter(s) to attach the tubes to the pump (1 four-way, or 2 two-way)
Pipette or dropper
Brown paper
Aluminum foil to cover the beakers with a hole drilled in them to allow the tubing attached to the aquarium pump to pass through

clock

teaching-time

One class period for set up
Two hours for collection and assembly of materials
10 minutes spread over several class sessions for periodic testing

testtubes

procedure

1. Discuss with students that they will be investigating oil-eating bacteria that occur naturally in soils. Divide students into teams. Provide each group of students with a list of materials from the list above. Ask them to design a test for the presence of oil eating bacteria, using the materials.

2. Remind them of the need to set up experimental controls to see if their soil bacteria brought about oil digestion.

3. List their ideas on the board and analyze the flaws and strengths of their plans. Points to discuss with the students:

• How can the industrial oil digesters designed for oil companies (which bubble air through contaminated water) be mimicked in their experiments? Ans.: By adding aquarium aerators to the experimental beakers

• How can the students determine if the bacteria have broken down oil? Ans.: by adding drops of water to paper disks. If an oily residue is left the oil is still present.

• How long should the experiments run? Ans.: Suggest they run for one month with weekly checks for oil.

• Discuss which variable was tested by each control in the design outlined below. Beaker 1 eliminates nutrients as a variable. Beaker 2 eliminates soils as a variable.

Suggested Experimental Protocol

1. Select two sites and collect two cups of soil from each. The sites should be contaminated with oil if possible, such as sites where junked cars have been for a period of time. Roadside ditches may also be more contaminated than garden or schoolyard soil and should have more naturally occurring oil-eating bacteria as a response to the contamination.2. All beakers, control and experimental, must contain the same amounts of materials (oil, water, nutrients, and soil). Have each group set up an array of four beakers as follows:

Control beakers:
Beaker 1: Water and oil only
Beaker 2: Oil, water, and nutrients

Experimental beakers:
Beaker 3: Oil, water, and soil sample
Beaker 4: Oil, water, nutrients, and soil sample

3. If the class size allows, assign each soil site to be tested by two groups in order to further verify results.

4. Use the aerators to pump air through all beakers, including the controls.

5. Once a week run a test for oil residue as follows. Cut a 6 inch square from a brown paper bag and cut it into quarters. With a dropper remove a sample of water from the test beakers and drop onto a square. As the water dries, check for oil residue, which will appear as a translucent spot on the paper.

  student-work
questionmark

questions

1. Which were the experimental beakers and which were the controls?

2. Why were the controls needed?

3. What variable did each beaker test for?

4. Did the oily residue decrease with each week of testing?

5. What role was played by the chemicals (nutrients) that were added to each beaker in the experiment?

6. Did the soil samples remove the oil? Was there any difference in the rate of digestion of oil between the two sites? ?

7. Was there any detectable difference in oil digestion between beakers 3 and 4?

8. Did the duplicate groups get the same results? If not what could have caused the variability?

9. What variables did you have no control over?

10. How could more oil-eating bacteria be generated in the event of an oil spill?

  teacher-key
answermark

answers

1. Which were the experimental beakers and which were the controls?

Beakers three and four were experimental.

2. Why were the controls needed?

To determine that it was really the soil and its bacteria that removed the oil

3. What variable did each beaker test for?

Beaker 1 eliminates nutrients as a variable. Beaker two eliminates soils as a variable

4. Did the oily residue decrease with each week of testing?

Answers will vary depending on individual results.

5. What role did the chemicals (nutrients) play that were added to each beaker in the experiment?

They stimulate the growth of the bacteria

6. Did the soil samples remove the oil? Was there any difference in the rate of digestion of oil between the two sites?

Answers will vary with individual results.

7. Was there any detectable difference in oil digestion between beakers 3 and 4?

Answers will vary with individual results.

8. Did the duplicate groups get the same results? If not what could have caused the variability?

Answers will vary; potential causes of variability among groups include experimental technique.

9. What variables did you have no control over?

Possibilities include temperature of the room over weekends, holidays, amount of light, etc.

10. How could more oil-eating bacteria be generated in the event of an oil spill?

Culturing and cloning the desired bacteria.

computer

references

Biotechnology Online. Accessed July 2009.

ER IVC 29. Developing Monitoring Protocols: How Do We Take the Pulse of the Environment?

Background

Environmental monitoring is used to track the health of a given ecosystem and to identify and assess the severity of the problems affecting various habitats and the organisms that live there. There are a variety of designs for successful environmental monitoring programs. Some use standard quadrants to count the numbers and types of organisms present in a given habitat and others count the total number of organisms that are causing changes in the environment. The “right” design for a monitoring program depends on what is being measured and what questions will be answered by the resulting data. Only consistent and standardized monitoring can identify problems and initiate the search for solutions.

This activity is a simulation that will teach students ecological monitoring techniques to solve a real-world problem in their local community. Biotechnology brings new tools to monitoring and helps identify emerging environmental issues. Although the instructor can suggest environmental problems, ideally the students should identify them.

PDF file PDF file for this project

 

Focus Questions

How is a sound environmental monitoring program designed?

notepad

objectives

Students will:
• Learn about real world environmental issues
• Understand the considerations involved in designing a rational environmental sampling program
• Collect and interpret surrogate data
• Apply problem solving skills to develop possible solutions to the problems presented

glass

materials

Copies of the scenarios below
Maps of local areas
Jars
Beans or other small objects in multiple colors
Small slips of paper with gene sequences

clock

teaching-time

Two class periods

testtubes

procedure

Students will read the “scenarios” below describing two environmental challenges for which monitoring is needed. Examine the Oyster beach and Algae beach maps provided (or provide your own if you’d like to use a map of your area) and follow the accompanying instructions for designing and implementing a mock monitoring protocol.

Scenario I: Shellfish Contamination

Background
Cholera is a deadly bacterial disease that can be transmitted by contaminated shellfish like oysters. Aside from making shellfish unsafe to eat, the presence of cholera in oyster beds can be an indicator of sewage pollution, since the disease is carried by contaminated human waste.

Oysters are filter feeders, meaning they strain their food from the water. If that water is contaminated with waste material, the oysters can concentrate the pathogens that cause cholera and hepatitis in their tissues. If humans eat contaminated oysters, they can become very ill or even die. In the United States several people are hospitalized each year for shellfish-related cholera. Even though most of these cases have been traced to Louisiana and Florida, a series of studies found bacteria in 19 percent of 58 pooled samples taken from United States waters where shellfish growing and harvesting are conducted (Ocean Atlas 2005). The health costs for an outbreak of cholera or hepatitis can be high. Purveyors of shellfish are also exposed to liability if they sell contaminated food. It might seem prudent to not sell oysters from beds where contamination has been reported, but what if contamination occurs only in a few small areas or at certain times of the year? Is it economically viable to close the entire bed to harvest when only a small portion may be contaminated?

Imagine you have been hired by a shellfish company to monitor oyster beds for the presence of cholera. The water samples taken indicate that the oyster beds are contaminated by coliform bacteria (which may indicate the presence of cholera bacteria or other disease-causing organisms). Cholera is caused by the bacterium Vibrio cholerae, whose presence can be determined by a simple antibody test. Your job is to decide the best way to monitor the oyster beds for cholera, and to decide when and where it is safe to collect and sell oysters. The more oysters the company can harvest and sell, the higher their profit margin, but only if the oysters are uncontaminated. You don’t want to put anyone’s health at risk or open the company up to legal liability by harvesting and selling contaminated oysters.

Scenario II: Invasive Species

Background
Invasive species are ones that have been transported outside their natural range. Although some invasive species seem to have very little impact on the environment, others can be extremely harmful, either eating or competing with native species. They may also carry diseases to which native organisms are not accustomed or immune, or they can change the nature of entire ecosystems by disrupting food webs or physical environmental conditions. Because species have evolved over time under a specific regime of selective pressure, they are often not prepared to handle the sudden introduction of new pressures. Competition can be an especially significant problem when invasive species are closely related and very similar to their native counterparts. For this reason, the invaders that can be the most harmful may be those that are most closely related to natives, also making them very difficult to detect. Even invaders of existing species that come from different populations that may have significant genetic differences or carry diseases. Some invaders are difficult to detect just by looking, so biotechnological techniques such as PCR may be required to ascertain the identity of an invader. We can also use the tools of biotechnology to determine the population from which they came, if there are different genetic markers in different populations.

In Hawaii, the invasive red alga Hypnea musciformis is very similar to the native alga Hypnea cervicornis. It is very difficult to tell these two species apart simply by looking. PCR identification of genetic markers can be used to differentiate species. Although scientists have not had an extensive opportunity to study the two species of Hypnea, other studies on invasive algae in Hawaii have shown them to be unpalatable to grazing herbivorous fish. If H. musciformis other studies on invasive algae in Hawaii have shown them to be unpalatable to grazing herbivorous fish. If H. musciformis holds to this pattern and outcompetes edible species in Hawaii, fish may not have an adequate food source. In addition, H. musciformis is well known for its tendency to aggregate and form large windrows, or piles, of algae on the beach washed up by the waves. As these piles of algae rot, the smell is very unpleasant and strong and can have a detrimental impact not only on private homeowners by reducing their property values, but on Hawaii’s tourist economy. Who wants to stroll along a beach covered with stinky, rotten algae?

Imagine that you are a natural resources manager in the state of Hawaii, and you have been charged with determining the extent of the H. musciformis invasion. Because resources for eliminating invasive algae are limited, the state wants to concentrate its efforts on areas that have high amounts of H. musciformis compared to native species. If you wanted to survey Hawaiian beaches for the presence of invasive H. musciformis,how would you choose samples of algae to test?

Monitoring Plan Development
For one or both of the described scenarios, students will prepare sampling schemes using local area maps or the prepared maps included here. Students will choose the sites to sample from the map’s grid overlay and then “sample” that site by drawing samples from jars containing predetermined ratios of results. Although students will not actually visit the areas selected on the map, they can model what a sampling bioassay would look like for either scenario outlined above.

1. Using your own map or the map provided, students will determine which sites are contaminated by cholera or invasive algae and the extent of the contamination. The jars represent sampling sites containing individual shellfish (beans) or algae samples (DNA sequences).

2. For scenario I, prepare three jars (A, B, C) for each group of students. Each jar, representing a shellfish bed, should contain 200 beans. White beans represent a negative bioassay result, or a clean animal; black beans represent a positive bioassay result, or a cholera-infected animal. Fill the jars in the following ratios to represent various degrees of contamination:

• Jar A represents a population with small amounts of cholera present—10 percent of the beans are black.
• Jar B represents an area where cholera is prevalent—80 percent of the beans are black.
• Jar C represents an area with a small percentage of cholera-infected animals—25 percent of the beans are black.

3. Students will examine the map and select sites to sample from the blank grid. Remind students that sampling should be random for best results. The sample map given shows a 5 mile area. Must the entire 5 mile area be sampled or will selected sites provide an adequate understanding of the problem? Have the students develop a method for choosing the sites to sample within the grid. The instructor can tell them how many sites they should choose, or the students can decide. The instructor’s master grid will be labeled A, B, and C to match the labels on the jars. After each group has chosen their sites, using the master grid the instructor will assign the jars from which to sample for each site.

4. Students will then “sample” their sites by drawing beans from the appropriate jar. Direct students to decide on their sampling methods beforehand; for example, they could scoop 20 beans from the jar at one time (no peeking!) or they could remove 1 bean. In a real oyster bed oysters would be picked randomly. How many beans do they need to draw from the jars to gather a representative sample of their population? Will they get the same results if they draw 2 beans versus if they draw 20 beans?

5. For scenario II, slips of paper containing PCR sequences will represent DNA samples taken from native and invasive species (sequences are included below). Put a total of 30 separate sequences into each jar. Use the same proportions as for the beans. Jar 1: few invasive species are present—10 percent of the algae are invasive; jar 2: 80 percent invasive species; jar 3: 25 percent invasive species.

6. Students will draw from the appropriate jars, based on their sampling plan (six slips of paper). Scientists (one team member) can then read the PCR sequences, compile data from sampling, and graph the results of their samples to represent the level of contamination.

These are sample sequences that represent a gene from the algae that can be used for species identification:

Native species ATCTGCCGAATGATAACACCGTTGCAT

Invasive species ATCGACGTGAATGACACATCGATGCAT

7. Students should compile their data and graph the results of their monitoring activities. List the location site and level of contamination with invasive or contaminated organisms from each sample taken.

8. Class results should be compiled as well. Are the patterns for each group the same as the overall pattern when all results are pooled?

  student-work
questionmark

questions

1. What did your results reveal about the pattern and extent of contamination?

2. How many samples (beans or paper DNA sequences) did you choose to take at each site? Do you think your sampling methods gathered enough data to identify the problem areas? If not what could be done to correct the problem?

3. Were your group’s results the same as for the class as a whole? Why or why not?

4. Human coliform bacteria, an indicator of other bacterial contamination, are known to be present in the area of your oyster beds. How could biotechnology help determine if the oysters are contaminated with cholera?

5. If there is any cholera present in your oyster beds, even in small amounts, would you open the beaches for harvest?

6. How would you go about identifying the source of cholera contamination in your oyster beds?

7. What factors might cause the patterns in invasive/native algae species abundance you observed?

8. What recommendations would you make to any federal, state, or local environmental agencies about the coastal areas you monitored?

9. What solutions might be applied to resolve the environmental problems that you are monitoring?

  teacher-key
answermark

answers

1. What did your results reveal about the pattern and extent of contamination?

Results will vary, but the included maps/grids tend to reveal highest cholera contamination where the creek meets the beach, attributable to the many sources upstream, and the highest incidence of invasive algae near the headland.

2. How many samples (beans or paper DNA sequences) did you choose to take at each site?

Do you think your sampling methods gathered enough data to identify the problem areas? If not what could be done to correct the problem?Larger sample size, more evenly spaced sampling areas to be sure more of the beach is sampled, more frequent sampling

3. Were your group’s results the same as for the class as a whole? Why or why not?

The pooled results will likely more clearly reveal the patterns described in #1, attributable to the increased sample size and spatial coverage of the pooled results.

4. Human coliform bacteria, an indicator of other bacterial contamination, are known to be present in the area of your oyster beds.

How could biotechnology help determine if the oysters are contaminated with cholera? Have the tissue analyzed for an antibody reaction to the cholera bacterium.

5. If there is any cholera present in your oyster beds, even in small amounts, would you open the beaches for harvest?

NO, it is too serious a health problem to risk.

6. How would you go about identifying the source of cholera contamination in your oyster beds?Look for potential sources of fecal contamination such as sewer outflows or runoff.

Cluster some samples in those areas and track back to the source(s).

7. What factors might cause the patterns in invasive/native algae species abundance you observed?

Is there a potential source of invasive species nearby, such as a shipping port where ships are carrying the invasives in their ballast water? Could wind and wave patterns stack algae on the beaches in a random pattern or concentrate the invasives in selected areas?

8. What recommendations would you make to any federal, state, or local environmental agencies about the coastal areas you monitored?

Answers will vary with individual results.

9. What solutions might be applied to resolve the environmental problems that you are monitoring?

Enforce stricter clean water laws. Invest in sewage plants that provide the highest level of cleaning water before release back into streams, bays, or oceans. Enforce strict land use laws that prevent the use of septic tanks that are known to contaminate water supplies. Implement monitoring and laws regarding invasive species. In some places, environmental advocates are seeking to have invasive species designated as a “contaminant” under the Clean Water Act. If so designated, they would have to be controlled just like chemical contaminants or nutrients. Discuss the pros and cons of this approach.

computer

references

UN Atlas of the Oceans. Health Risks on the Rise. Accessed July 2009.