Available Internships

Summer/Fall 2021 Beginning Researchers Support Program

Ground-truthing Satellite-based Water Use Efficiency Estimates for Oregon Vineyards

Faculty Mentor Name:  Stephen Good
Faculty Mentor Department: Department of Biological & Ecological Engineering

Student research work will be: Hyrbid of remote and in-person

Project Abstract:

How efficiency agricultural plants use water influences both the amount of resources they require and the expected yield obtained.

In this project we will evaluate the utility of NASA products for determining the water use efficiency of vineyards in Oregon. Specifically, we will obtain ground based estimates of plant water use efficiency (defined as the ratio of gross primary productivity over water lost) and compare these to estimates from the ECOsystem Spaceborne Thermal Radiometer Experiment on Space Station (ECOSTRESS). This analysis will provide an estimate of how well the ECOSTRESS products translate to vineyard-level estimates.

The Job - Project Description:

The student will work with the project supervisor (Stephen Good) and project collaborator (Alec Levin) to obtain data from the NASA ECOSTRESS project at field sites monitored by Dr. Levin. The student will then need to organize and these data so they can be compared with field data. Statistical tests and regression models may be built to compare the field and satellite data.

Description of work environment:

Student will principally work from home on their computer. Field work, if possible will involve trips to vineyards throughout Oregon to collect leaf and grape samples.

Description of Student Responsibilities:

Student will be responsible for obtaining ECOSTRESS data, organizing it, and comparing it with on the ground data. Some field work (collecting grape and leaf samples) at field work is possible at the end of the summer.    

Skills:

Familiarity with programing (ideals python) is preferred. The majority of the work for this project will involve organizing data and analyzing it with python based statistical tools.

Learning Outcomes:

Student will learn how to download, pre-process, and analyze satellite data.

Expected start and end date: June 1 to Oct 1    
Anticipated hours per week: 5 - 10, though there may be more during weeks we are collecting field samples
Anticipated hourly wage: $12/hr

Remote sensing and on-the-ground surveys to assess habitat quality for fish and waterbirds along the Pacific Coast

Faculty Mentor Name: Melanie Davis
Faculty Mentor Department: Department of Fisheries and Wildlife

Student research work will be: Hyrbid of remote and in-person

Project Abstract:

The Pacific Northwest's many coastal estuaries and river deltas are vital rearing habitats for Pacific salmon and provide roosting and foraging habitats for migratory waterfowl. A variety of geomorphological and biological features such as tidal channel morphology, marsh vegetation, native and invasive eelgrass beds, and aquaculture can drastically affect how fish and wildlife access and benefit from delta habitats. For this project, the undergraduate student will work closely with federal and tribal partners to collect and analyze a variety of remote sensing and empirical data sets, including GPS surveys of delta habitat features, vegetation surveys, eelgrass and burrowing shrimp surveys, waterbird surveys, and aerial and lidar imagery. The student will have the freedom to determine the scope of their research, with opportunities to collect data in the field and work with existing data sets in a remote setting. Research will take place in the restored Nisqually River Delta and in Willapa Bay and Grays Harbor, Washington, and field components may require overnight travel. The ideal candidate for this position is comfortable working on small motorboats and airboats, is willing to work in wet and (extremely) muddy conditions, has a positive attitude in the field, pays meticulous attention to detail, and has reliable working knowledge with data management in excel. Basic experience with RStudio or ArcGIS is a major plus, but not necessary. The student will develop skills in field work, data management, and basic statistics, with the opportunity to author or co-author a peer-reviewed journal article.

The Job - Project Description:

The student will have the opportunity to assist with two projects occurring in the Pacific Northwest; one restoration monitoring project in the Nisqually River Delta and one project examining the effects of burrowing shrimp on native fish and migratory waterfowl in Willapa Bay and Grays Harbor. Both projects examine how geomorphological and biological features such as tidal channel morphology, marsh vegetation, native and invasive eelgrass beds, and aquaculture affect how fish and wildlife access and benefit from delta habitats. Descriptions of each are provided below:

Nisqually River Delta research: The Nisqually River Delta provides important feeding and rearing habitat for a diversity of fish and wildlife, including estuary-dependent salmonids such as Chinook salmon (Oncorhynchus tshawytscha). Nisqually’s fall-run Chinook salmon stock are a prized cultural, economic, and ecological resource, but they are listed as threatened under the Endangered Species Act. Beginning in the 1990s, the Nisqually Indian Tribe and Billy Frank Jr. Nisqually National Wildlife Refuge collaborated to restore over 308 ha of estuarine habitat to tidal influence for the benefit of juvenile Chinook salmon and other estuary-dependent species. In collaboration with the USGS, the Tribe and Refuge have continued to gauge restoration success with respect to geomorphological change, invertebrate prey resources, and juvenile salmon habitat use, diet, and growth, yet there remain significant opportunities to study the effects of improved habitat connectivity, augmented sediment inputs, and resilience to sea level rise on the delta’s restoration trajectories and the Nisqually Chinook salmon stock. New data are being collected to supplement more than a decade of existing geomorphological and biological monitoring datasets. For example, in Winter 2021 the Nisqually Tribe acquired topobathymetric lidar imagery. The topobathymetric lidar coverage area includes a variety of habitat types throughout the Nisqually River Delta and can be used to inform models and measurements of habitat change and sediment transport.

Our overarching goal is to provide analytical support for the Tribe as they continue to gauge restoration success and consider targeted management actions for Nisqually salmon and habitat. We aim to do this by satisfying the following objectives: 1) Expand upon existing monitoring datasets and analyses to quantify the opportunity, capacity, and realized function of the restoring delta for Chinook salmon and other wildlife, 2) Build upon decision support tools such as models of habitat change, fish growth potential, and analyses to inform habitat and stock management plans, and 3) Provide support for statistically-sound experimental research design, implementation, and analysis to assess juvenile Chinook salmon life history strategies, habitat use, and survival, and to inform habitat and stock management plans.

Willapa Bay and Grays Harbor research: Neotrypaea californiensis, commonly referred to as the ghost shrimp, is a native, burrowing deposit feeder found in tidal flats along much of the North American Pacific coast. In the Pacific Northwest, ghost shrimp populations were stable until the 1950s when local oyster growers noticed a surge in shrimp numbers. The ghost shrimp population was initially controlled using the pesticide carbaryl, but in 2012 concerns from the public put an end to its use. Now, despite the availability of alternative pesticides (e.g., imidacloprid), ghost shrimp populations have continued to increase. Numerous studies have explored the impacts of dense ghost shrimp beds on the Pacific Northwest aquaculture industry; however, there is little information about their potential effects on coastal habitats’ ability to support migratory birds or demersal fish. This includes factors like prey abundance, availability, and quality; the influence of ghost shrimp as ecosystem engineers; and the effects of ghost shrimp on native and non-native eelgrass beds (Zostera spp.), which serve as refugia and food for many fish and wildlife species. This research aims to address this gap in knowledge by pursuing the following research objectives: 1) identify habitat features associated with varying densities of N. californiensis, including tidal inundation regimes, sediment and water quality, eelgrass density, and proximity to aquaculture, 2) quantify invertebrate prey abundance, accessibility, and energy content in habitats with varying densities of N. californiensis, and identify resultant differences in food web linkages, and 3) relate waterbird habitat use and behavior to invertebrate prey communities and physical habitat characteristics. This comprehensive analysis of ghost shrimp-affected coastal ecosystems will guide management decisions regarding habitat restoration and mitigation to promote productive prey resources, thereby benefiting target species that rely on a variety of high-quality invertebrate prey.

Description of work environment:

The student will conduct field work alongside USGS and USFWS collaborators, while data management, analysis, and writing tasks can be conducted remotely. Field work will take place in the Nisqually River Delta, Willapa Bay, and Grays Harbor, Washington, and will require overnight travel staying in either Astoria, OR, or Olympia, WA. The Nisqually River Delta is a large river delta in southern Puget Sound with large swaths of restored and historically unaltered tidal marsh. Sampling sites are located in high- and low-elevation marshes that will be accessed by foot or by boat. Willapa Bay and Grays Harbor are located in southwestern Washington. Both are shallow bays with wide swaths of mudflat habitat. Most sites will be accessed by airboat. After data collection, the student can work remotely to enter and conduct quality control/quality assurance on the data. They may be asked to make simple graphs in figures in excel to present results to our federal partners. The student is welcome to use their own computer, or to use on-campus computing resources provided by the Oregon Cooperative Research Unit.

Description of Student Responsibilities:

The student's day-to-day responsibilities will vary depending on their interests and schedule, and may include: 1) Collecting GPS points in tidal marsh by boat or by foot, 2) Conducting marsh vegetation surveys, 3) Identifying native and non-native eelgrass beds and ghost shrimp burrows while working on an airboat, 4) Collecting benthic invertebrate samples in tidal mudflats, 5) Entering and managing ecological data sets, 6) Using public sources to identify appropriate spatial data sets, 7) Data analysis and interpretation using basic statistical techniques, depending on the student's experience and comfort level, 8) Writing up methods and results for scientific reports and publications.

Skills:

The ideal candidate for this position is comfortable working on small motorboats and airboats, is willing to work in wet and (extremely) muddy conditions, has a positive attitude in the field, pays meticulous attention to detail, and has reliable working knowledge with data management in excel. Basic experience with RStudio or ArcGIS is a major plus, but not necessary. The student will be required to work independently conducting remote, data-oriented tasks, and as part of a team doing field work with graduate students and federal collaborators. They will develop skills in field work, data management, and basic statistics, with the opportunity to author or co-author a peer-reviewed journal article.

Learning Outcomes:

While participating in this research, the student will learn a variety of valuable scientific skills including: operating handheld and real-time kinematic (RTK) GPS units, identifying Pacific Northwest coastal vegetation, conducting ecological surveys in coastal habitats by boat and by foot, data entry, management, and quality control in excel, basic data analysis in excel and RStudio, and how to communicate results in scientific reports and peer-reviewed journals.

Expected start and end date: This position is available July-September. The expected start and end date are flexible depending on the student's schedule and research interests.
Anticipated hours per week: Anticipated 20 hours per week   
Anticipated hourly wage: $12.50/hr (negotiable)

Research in Agriculture and Natural Resources Communication

Faculty Mentor Name: Cara Lawson
Faculty Mentor Department: Department of Agricultural Education & Agricultural Sciences   

Student research work will be: Entirely remote/virtual

Project Abstract:

Agricultural and natural resources communication is a dynamic and evolving field. Research project opportunities are available for exploring media framing and message testing pertaining to complex issues facing rural societies from standpoints of communication, the economy, health, infrastructure, and more.

The Job - Project Description:

Undergraduate researchers will assist with tasks such as research question development, literature reviews, data analysis, and reporting results for an agreed-upon research project in agriculture and natural resources communication.

Description of work environment:

This research can be conducted virtually. However, depending on the student's availability there may be opportunities to collect data on site or within a laboratory setting.

Description of Student Responsibilities:

Students will be major contributors to the research project and will take key roles in developing the study, analyzing the data, and reporting results.

Skills:

Strong writing skills are preferred. A working knowledge of APA writing style is helpful, but not required.

Learning Outcomes:

  • describe sources of research problems
  • develop a problem statement
  • create research questions or objectives
  • evaluate and analyze data
  • report findings

Expected start and end date: August - December 2021
Anticipated hours per week: 4
Anticipated hourly wage: $12.50/hr

Exploration of native entomopathogenic nematodes associated with sod webworm, Chrysoteuchia topiaria (Zeller) (Lepidoptera: Crambidae) in Oregon grass seed crops.

Faculty Mentor Name: Navneet Kaur
Faculty Mentor Department: Department of Crop and Soil Science

Student research work will be: In-person lab/field

Project Abstract:

Oregon (OR) is the leading grass seed (fescues, ryegrass, bluegrass, etc.) producing state in the nation, with over 400,000 acres in production each year. Insect pest issues like sod webworm and billbugs are a continual concern for grass seed producers, as only a limited number of insecticides are currently available, and these products are challenging to use effectively because the post-harvest residues in most grass fields tend to adsorb insecticides before they can reach the targetted life stages of these soil-dwelling insects. Due to the lack of effective control measures, alternative methods, including microbial control agents such as entomopathogenic fungi or entomopathogenic nematodes (EPNs), are needed. For adoption and establishing potential use patterns of the microbial control program for insect management in grass seed crops, information on distribution, species composition, parasitism rates, and annual lifecycle fluctuations of beneficial microbes are needed. The main aim of this study is to determine what species of beneficial microbes exist in the western OR and whether the
candidate species that occur in grass seed production systems can become a promising microbial control agent.

The Job - Project Description:

Oregon (OR) is the leading grass seed (fescues, ryegrass, bluegrass, etc.) producing state in the nation, with over 400,000 acres in production each year. Insect pest issues are a continual concern for grass seed producers, as they impact profitability due to the direct and indirect (disease vectors) damage they cause, in addition to associated control costs ($10-$15/acre). In particular, grass seed growers have identified the sod webworm, also known as cranberry girdler, as the most problematic insect pest issue. This pest has a relatively wide host range and inflicts damage across multiple grass seed species, and is persistent in nature. A limited number of insecticides are currently available, and these products are challenging to use effectively because they rely on sufficient fall rains for soil incorporation. Due to the lack of effective control measures, alternative methods, including biological control agents such as entomopathogenic nematodes (EPNs), are needed. Native/indigenous EPN species are expected to have better potential than exotic species to control the local insect pests due to their specificity and better adaptability to the local environmental conditions. Furthermore, EPNs have been exempted from federal and state registration requirements, greatly facilitating their development and distribution for insect pest management across many agricultural and horticultural systems. The commercial use of beneficial/ parasitic nematodes or EPNs to control soil-borne insect pests is limited to nursery production or turf systems in OR. For use in grass seed systems, knowledge on distribution, species composition, parasitism rates, and annual lifecycle fluctuations are needed to establish potential use patterns. The objectives of this project are to 1) conduct area-wide surveys in the commercial grass seed production systems to determine the occurrence and distribution of EPN species in western OR, 2) identify the isolated EPNs using molecular techniques and maintain lab cultures for infectivity tests), 3) to conduct infectivity trials using EPN species identified during the survey and comparing their efficacy to the commercially available EPN based products against sod webworm under laboratory conditions.

Objective1) Surveys in the commercial grass seed production systems in OR. Sampling methods will be modified from Sandhi et al. 2020. At least 15 grass seed fields (tall fescue, fine fescue, ryegrass, or orchardgrass) in Oregon with a history of sod webworm infestation will be selected for the survey of native EPNs.

Approximately 10 to 15 cm deep soil samples will be collected using a hand shovel within each of five random plots (8-10 m2). Between samples, the shovel will be thoroughly brushed and rinsed with 70% ethanol to prevent contamination between samples or parts of the field. Five random samples from each plot will be combined to make one composite sample. The collected samples will then be placed in polyethylene bags to prevent water loss and kept in coolers (10°C) during transit to the laboratory. Field sites will be sampled every two weeks during March-June 2021 to gain insights into the population dynamics of EPN species occurring in grass seed fields and their potential to infect various insect life stages.

EPNs will be extracted from the soil samples in the laboratory with the insect-baiting techniques as described in Orozco et al. 2014. In brief, within a week of soil sampling, a 300 g subsample is transferred to a 500 ml plastic container. For baiting, five final instar larvae of wax worms, Galleria mellonella Linnaeus (Lepidoptera: Pyralidae), will be placed in each container with the soil sample. The wax worms are commercially available and are widely used in baiting studies and for maintaining lab cultures of EPN species in the laboratory (Orozco et al., 2014). The container with larvae will then be kept in the dark room with an ambient temperature for about a week. Containers will be checked daily for any signs of EPN infection (such as discoloration of host cadaver) in wax worm larvae. In addition to data on the wax worms' parasitism, associated EPNs will be isolated using the following procedure: Infected larvae will be removed from the container, rinsed with water, and placed in modified White traps (Orozco et al., 2014) until EPN emerges. In white traps, dead larvae infected by EPNs (cadavers) will be kept on a small Petri dish inside a bigger Petri dish with a water film. White traps will be incubated at room temperature (~22°C) and observed daily for infective juvenile (IJ) emergence. Once IJs emerge from the cadavers, they are collected from the White traps every two days with a pipette, washed 2-3 times, and suspended in fresh tap water. The collected IJs will be stored at 8-10°C (depending on the species) in tissue culture flasks and used within 10 days of collection.

Objective 2) Identification and maintaining lab cultures of candidate EPNs. After successful isolation of EPN, species will be identified using molecular techniques. For molecular analysis, DNA of nematode species will be extracted using the DNA extraction protocol (DNAeasy Blood and Tissue Kit). The thermal cycler program for PCR will be according to parameters described in Ye et al., 2018: denaturation at 95°C for 5 min, followed by 35 cycles of denaturation at 94°C for the 30s, annealing at 55°C for 45s, and extension at 72°C for 2min. A final extension will be performed at 72°C for 10min. Primers for ITS1 amplification will be forward primer rDNA2 (5′ TTGATTACGTTCCCTGCCCTTT 3′) (Vrain et al., 1992) and reverse primer rDNA1.58S (5′ ACGAGCCGAGTGATCCACCG 3′) (Cherry et al., 1997). Primers for CoxI amplification will be forward primer COI-F1 (5′ CCTACTATGATTGGTGGTTTTGGTAATTG 3′) and reverse primer COI-R2 (5′ GTAGCAGCAGTAAAATAAGCACG 3′) (Kanzaki and Futai, 2002). Targeted products will be amplified using 1% agarose gel, and PCR products will be cleaned up using Invitrogen PCR quick clean-up kits. Samples will be sent for direct sequencing at the OSU Center for Genome Research and Biocomputing. The data obtained from the sequencing lab will be compared to the information present in the NCBI GenBank database for species identification.

After confirming the EPN species, nematode cultures will be maintained in the laboratory until further testing according to methods listed in Sandhi et al. 2020. For rearing in the laboratory, 10-20 waxworm larvae will be placed in 90 mm Petri dishes lined with a single layer of Whatman No. 1 filter paper. Petri-dishes will be then inoculated with 1000-2000 IJs in 2 ml of water with approximately 100-200 IJs/larva and kept incubated at room temperature (~22°C) for 4-5 days. Dead larvae will be transferred to White traps and kept until the next generation of EPN emerges. The infective juveniles collected from White traps will be used to infect more waxworms. All nematodes will be cultured simultaneously but handled separately at different times in the workspace to avoid cross-contamination.

Objective 3) Infectivity trials. A lab colony of sod webworms from known sites with a historic infestation will be initiated by collecting adults via sweep net sampling in May-June and allowing them to lay eggs inside caged solo-cups containing an artificial diet maintained at 25°C  and 14:8h L:D photoperiod. The efficacy will be evaluated in the laboratory by using lab cultures of EPN species identified in this study and comparing their efficacy against one or more commercially available EPN products readily available in the market (e.g., BioVector, and Nemasys applied at manufacturer’s recommendations) against lab-reared sod webworm larva.

Testing arenas will be constructed using 90mm wide and 15 mm tall Falcon Petri dishes lined with filter paper. Petri dishes with five sod webworm larvae, each with candidate EPN will be inoculated with 100-200 IJs/larva, suspended with 1-2 ml of water (Sandhi et al. 2020). Petri dishes with no EPN (negative controls) will receive just 1-2 ml of water and five insects. Ten replications will be made. The dishes will be stored in drawers, at room temperature, and monitored every day for up to 10 days; dead larvae will be counted in each dish. Percent mortality data of sod webworm larvae will be subjected to analyses using ANOVA methods.

Description of work environment:

Primary Location: Field Crops Entomology lab located in ALS building- 3rd floor.
Field Work: Collecting soil samples in  commercial grass fields near campus

Description of Student Responsibilities:

Assist in soil sampling, set up soil baiting for extraction, Data collection, Maintaining lab cultures of EPN species, Assist in DNA extractions and PCR set up, Conduct infectivity trials    

Skills:

Lab bench skills, Competence in insect rearing and maintaining EPN cultures, Microscopy, Microsoft Office, and infographics, good communication skills

Learning Outcomes:

Students will gain an understanding of insect microbial control, hands-on experience in insect rearing and maitaining EPN cultures. Authorship in extension and peer-review manuscripts, opportunities to present in Entomological Society  of America meetings

Expected start and end date: 1-Jun
Anticipated hours per week: 20
Anticipated hourly wage: $13/hr

Detection of low head dams: Reducing fatalities with data

Faculty Mentor Name: Desiree Tullos
Faculty Mentor Department: Department of Biological and Ecological Engineering Department

Student research work will be: Hyrbid of remote and in-person

Project Abstract:

Entirely remote/virtual    There are just over 91,000 dams registered in the US National Inventory of Dams, but it is expected that there are 2,000,000 undocumented dams across the US. The vast majority of those undocumented dams are small, block fish passage, and have resulted in over 550 known fatalities to river recreationalists. This project involves contributing to a national effort to document the locations of low head dams, allowing us to finally identify how many dams exist across the landscape, and to reduce their impacts of ecosystems and people. In partnership with multiple researchers across the nation, the student research will work to identify the locations of small dams in Oregon using one of three methods: 1) Applying GIS tools for automated detection of dams; 2) direct contact with state officials and watershed managers; and 3) detailed scans of river networks using Google Earth. In addition to these technical skills and learning about dams and dam impacts, the student will gain exposure to strategies for managing a diverse research team through participation in meetings of the national project team, and will receive focused mentoring throughout the project by Desiree Tullos and Cara Walter.

The Job - Project Description:

It is expected that there are 2,000,000 undocumented dams across the US. The vast majority of those undocumented dams are small, block fish passage, and have resulted in over 550 known fatalities to river recreationalists. Small dams block migratory fish from accessing the headwaters of river basins where they can find cool water and high quality habitat. In addition, many small dams create dangerous currents near the downstream face of the structure that are extremely hard to escape, resulting in them being informally called “drowning machines.” Simultaneously, the budget for managing the safety of our nation’s aging dams is at its lowest in history. The locations and characteristics of these small dams are poorly documented, which makes it difficult to assess the extent of the issues or secure funding to address the environmental and life safety concerns.

This project aims to contribute to a national effort to document the locations of small dams across the US. Project partners include researchers at three universities and practitioners at two consulting firms, so students would interact with both a research team at OSU (Desiree Tullos, Cara Walter) and with a project team beyond OSU.

The key tasks, depending the student’s skills and interests, will include:
1) Applying Geographic Information Science (GIS) tools for automated detection of dams;
2) Direct contact with state officials and watershed managers to acquire their data on small dams;
3) Detailed scans of river networks using Google Earth; and
4) Integrate the three above sources of dam locations into a single database to be delivered to project partners.

Algorithms for each of these tasks have been developed by the national team, so the student would be using established and well-documented approaches that are consistent with the broader national database. Further details are provided under student responsibilities below.
In addition to the technical tasks listed above, the student will participate in and gain practice leading group meetings, attend professional development and topic webinars, and be directly guided and mentored by two faculty members on developing technical skills, gaining confidence in STEM identity, and exploring career pathways.

Ultimately, developing this database will facilitate raising awareness, generating interest, and educating the general public and decision makers regarding these dangerous and destructive structures and the need for remediation.

Description of work environment:

Work will be conducted in an office setting and generally on a schedule that suits the students' needs. We will also meet weekly as a project team, and communicate via email or teams.

Description of Student Responsibilities:

The student will:

  1. For students with prior GIS experience, they can apply an existing, established workflow to scans topographic data for automatically identifying dams.
  2. Directly contact state agencies (ODFW, OWRD), local watershed groups, soil and water conservation districts, and other groups to acquire known dam locations
  3. Download hydrography datasets for Oregon rivers and scroll down through river networks in Google Earth to manually identify the coordinates of dams
  4. Integrate all of the above datasets into a single file and export as a Google Earth kmz

Skills:

  • GIS (desired, gained during project)
  • attention to detail (required, gained during project)
  • data management and documentation (gained during project)

Learning Outcomes:

  • produce and deliver a database of low head dam locations in the state of Oregon
  • practice professional communication with a range of audiences
  • gain experience integrating and documenting multiple geospatial datasets
  • deepen knowledge around dams and their hazards

Expected start and end date: July 2021 to Dec 2021
Anticipated hours per week: 4
Anticipated hourly wage: $13/hr

The Effects of Milking and Cleaning Procedures on the Quality and Microbiome of Raw Goat Milk

Faculty Mentor Name: Si Hong Park
Faculty Mentor Department: Department of Food Science and Technology

Student research work will be: Hyrbid of remote and in-person

Project Abstract:

In Oregon, goat milk serves as a form of nutritional sustenance for homesteaders and a source of revenue for licensed small-scale farm producers. The purpose of this research is to assist small-scale goat dairy farmers in measuring the effects of their milking and cleaning procedures on raw goat milk production. A total of 5 local farms possessing 4 to 10 lactating goats will be included for this study. Raw goat milk collected from each farm will be analyzed to count aerobic, coliform bacteria, and somatic cells associated with the quality as well as determine the difference in the microbiome of raw milk. Samples will be collected three times per month for 2 months, with a total of 6 samples per farm. During the sample collection, milking and cleaning procedures will be recorded in detail including cleaning agents with contact time, equipment, milking parlor setup, breed, stage of lactation, and age of animal. We expect that there will be a quantitative difference of the milk quality based on the standard procedures utilized, such as the type of equipment used and cleaning methods employed. This will benefit the Oregon community by further assessing the effectiveness of standard operating procedures utilized by small-scale goat milk producers and in turn increase the quality of raw goat milk production. The student will gain general and molecular-based microbiological techniques (plate counting, DNA extraction, microbiome sequencing, and bioinformatics). The student will be expected to work 4 hours per week and hourly wage is $12/h.

The Job - Project Description:

The purpose of this research is to assist small-scale goat dairy farmers in measuring the effects of their milking and cleaning procedures on raw goat milk production. A total of 5 local farms possessing 4 to 10 lactating goats will be included for this study. Raw goat milk collected from each farm will be analyzed to count aerobic, coliform bacteria, and somatic cells associated with the quality as well as determine the difference in the microbiome of raw milk. Samples will be collected three times per month for 2 months, with a total of 6 samples per farm. During the sample collection, milking and cleaning procedures will be recorded in detail including cleaning agents with contact time, equipment, milking parlor setup, breed, stage of lactation, and age of animal. We expect that there will be a quantitative difference of the milk quality based on the standard procedures utilized, such as the type of equipment used and cleaning methods employed. This will benefit the Oregon community by further assessing the effectiveness of standard operating procedures utilized by small-scale goat milk producers and in turn increase the quality of raw goat milk production.   

Description of work environment:

Local farms: Sample collection
Campus lab (WGND 242): Sample process and microbiological analysis
Home: Data analysis with a computer

Description of Student Responsibilities:

1. Student should collect milk samples with detailed information
2. Preparing reagents and consumables in the lab, processing samples, and cleaning a lab after experiment
3. Data analysis using a computer

Skills:

The student will gain general and molecular-based microbiological techniques.

  1. Bacterial cell counts using an aerobic plate method
  2. DNA extraction from milk
  3. Microbiome sequencing
  4. Sequencing data analysis using bioinformatics tools

Preferred: Food science, microbiology related major, lab experience

Learning Outcomes:

Student will learn how farming practice will affect the microbial populations in goat milk.
The effects of milking and sanitation procedure on quality of milk.

Expected start and end date: 6/15/2021-11/15/2021
Anticipated hours per week: 4
Anticipated hourly wage: $12/hr

Characterizating of elk forage quality and quantity prior to fuels reduction treatments in moist mixed conifer forests in the Blue Mountains

Faculty Mentor Name: Bryan Endress
Faculty Mentor Department: Eastern Oregon Agriculture and Natural Resource Program

Student research work will be: Hyrbid of remote and in-person

Project Abstract:

In response to more than a century of fire suppression in forests of interior Pacific Northwest, efforts are underway to thin over-stocked forest stands to improve forest health and reduce the likelihood of large, intense stand replacing fires.  A wide range of land uses and human and natural disturbances occur on public lands that affect elk, including stand thinning. Effects of these land uses and disturbances can be challenging to study because long-term responses of elk can be substantially different than short-term. It is thought that elk will benefit from such silvicultural treatments because opening of the forest canopy will allow more sunlight to reach the understory resulting in increased production and quality of key forage species. However, that must be evaluated. This project, which will occur at Starkey Experimental Forest and Range in northeastern Oregon, will collect baseline data on elk forage condition immediately before stand thinning, so that following treatments, we can quantify changes in forage quantity and quality. Knowledge of elk forage condition following silvicultural treatments is important for managers' understanding of the benefits of thinning treatments in improving elk forage and elk distribution, how long such benefits may last post-treatment, and the magnitude of short and long-term benefits. This work is part of an integrated research effort on elk habitat-use responses to fuels reductions typical of prescriptions now being implemented across National Forests in the Blue Mountains.

The Job - Project Description:

Historic fire suppression and past silvicultural treatments have created mixed-conifer forest stands with increased overstory tree densities and high levels canopy closure throughout the Blue Mountains in NE Oregon. These altered conditions have negatively impacted a range of ecological interactions and forest resources. For elk, reductions light reaching the forest understory has negatively affected the availability, quantity and quality of forage species critical for elk diet and nutrition. In response to current concerns about forest health, widespread, large-scale silvicultural treatments focused on fuels reduction and stand thinning are planned across federal forests in the region. It is hypothesized that elk will benefit from such silvicultural treatments because opening of the forest canopy through stand thinning will allow more sunlight to reach the understory resulting in increased production and quality of key forage species. The long-term goal of this project is to test this hypothesis and quantify changes in forage availability, quality and quantity following standing thinning and fuels reduction. To do this, we first must characterize forage quantity and quality under current forest conditions prior to silvicultural treatments. This project will collect pre-treatment data on forage availability, quantity and quality in forest stands slated for fuels reduction treatments later this year within the Syrup Creek unit of Starkey Experimental Forest and Range. This work builds on the long-term research in Syrup Creek related to forest management, elk nutrient, movement and distribution. Approximately 6 mmbf of dry and mixed-conifer forests were commercially harvested in 1992-1993 in Syrup Creek as part of Starkey research to evaluate ungulate responses to habitat changes. That research was completed in the 1990s (e.g. Wisdom et al. 2004). Following timber harvest, the area was divided into two treatments with different elk densities ('low' and 'high') and cattle and mule deer excluded; these treatments have been maintained since. This presents an opportunity for new research that 1) evaluates long-term effects of thinning on elk forage 28-29 years following timber harvest, 2) characterizes current forage conditions under two different elk densities and 3) collects forage quality and quantity information to serve as baseline data for a before-after controlled-impact (BACI) evaluation to determine the degree to which planned silvicultural treatment improve the quality and availability of forage in mixed conifer stands. Given the planned widespread implementation of stand thinning and fuels reduction treatments across mixed-conifer forests of the Blue Mountains in the coming years, it is critically important to understand and quantify how these treatment will affect forage resources. This research will provide valuable information to inform efforts to improve elk management in the region.

Specific objectives include:

  1. quantify current availability and quantity of key elk forage species by season (spring, summer, fall) in overstocked mixed conifer forests stands under low and high densities of elk.
  2. quantify forage quality: digestible energy (DE, kJ/g) and digestible protein (DP, g protein/100 g) of key elk forage species by season (spring, summer, fall) in overstocked mixed conifer forests stands under low and high densities of elk.
  3. Collect baseline (pretreatment) data on elk forage availability, quantity, and quality in overstocked mixed conifer forest stands planned for stand thinning in the fall/winter of 2021-22, as part of a longer-term BACI experiment to quantify how elk forage responds to thinning treatments

Data collection will occur in ten mixed-conifer forest stands within Syrup Creek scheduled to undergo stand thinning treatments in the fall/winter of 2021. Five stands will be located in the high elk treatment of Syrup Creek and five established in the low elk density treatment. Plots  (based on FIA protocols/layout) will be established within each stand to collect data on overstory stand density and structure (following FIA protocols) and canopy closure. To quantify forage quantity and quality, within each plot, we will establish 16 1m2 quadrats where we will estimate percent canopy cover of 10 key forage species. Species include key graminoid, forb and understory shrub species: heartleaf arnica (Arnica cordifolia), fireweed (Chamaenerion angustifolium), yarrow (Achillea millefolium), elk sedge (Carex geyeri), pinegrass (Calamagrostis rubescens), Idaho fescue (Festuca idahoensis), twinflower (Linnaea borealis), rose (Rosa spp.), snowberry (Symphoricarpos albus), and bearberry (Arcrtostahylos uva-ursi). We will also collect vegetation samples for lab analysis of forage quality: digestible energy (DE, kJ/g) and digestible protein (DP, g protein/100 g). We have developed multiple regression models that allow us to estimate forage biomass based on field cover estimates with a high degree of accuracy (e.g. r2 consistently over 0.8); we will use these models to quantify forage quantity (lbs. per acre). Plots will be sampled three times (April, June, September), with forage quantity and quality data collected each time. This will allow us to characterize changes in elk forage across the growing season. Additionally, our approach will allow us to not only evaluate forage quantity and quality in relation to current stand conditions (stand density, canopy cover, slope, aspect, etc.) and elk densities (low, high) but will also serve as critical pre-treatment baseline data so that we will be able to quantitatively evaluate forage responses to fuels treatments in the future (we plan to resample 2 and 6 years after treatments) as part of our BACI experiment.

Starkey Experimental Forest and Range is site of numerous stakeholder and educational tours.  Sharing results from this study on the impact of thinning treatments on the condition of elk forage will be a prominent tour stop. The results of the proposed research has direct relevance to answering questions about the role of stand thinning in influencing forage availability and quality. It will also provide critical information on understanding how well elk can be attracted to, and can maintain their distribution, on public lands with the use of understory thinning and other silvicultural practices that open up the canopy and increase forage quantity and quality for elk. The results will further validate the new elk habitat use model for the Blue Mountains, which has been designed to evaluate summer elk distributions on public lands and adjacent private agricultural lands. In addition, this study will provide valuable insight to how past management activities affect elk forage (which in turn affects elk health and distribution). The past timber harvests in Syrup Creek were implemented across large portions of the Blue Mountains, and like Syrup Creek, subsequent silvicultural treatments never occurred. Therefore current conditions in Syrup Creek are representative of much of the mixed conifer forests of the Blue Mountains. Thus this project will serve as a great case study to quantify the legacy effects timber harvest without subsequent management treatments on elk forage condition, in addition to setting the stage for understanding how forage quality and quantity change under planned treatments. This will contribute to long-term research on ungulates in response to a wide variety of natural and anthropogenic disturbance agents and regimes.

Description of work environment:

Work will include supervised field data collection at Starkey Experimental Forest as part of a field team as well as work at home on the computer (data entry, analysis, etc.), as needed (we will provide computer if needed). Starkey is approximately 45 minutes from La Grande, Oregon.

Description of Student Responsibilities:

Responsibilities include collecting field data in forest stands in Starkey Experimental forest as part of a team. This includes collecting ecological data on species

Skills:

Preferred:

  1. Experience spending long days in wildland settings under a variety of weather conditions.
  2. Willingness and excitement to learn and problem solve in a real-world research setting
  3. Interest in monitoring, management, and restoration of ecosystems and natural resources.

Learning Outcomes:

  1. Identify important elk forage plant species by site
  2. Learn methods to characterize plant species abundance and biomass in the field and apply methods within a research framework
  3. Collect and prepare plant samples for nutrient analysis
  4. Collect and analyze natural resource data using standard mythologies
  5. Create and generate summary statistics and graphical display results

Expected start and end date: 6/15 - 9/15
Anticipated hours per week: 40
Anticipated hourly wage: $13-15/hr

Developing a novel contraceptive vaccine against SPRASA for use in wild horses

Faculty Mentor Name: Michelle Kutzler
Faculty Mentor Department: Department of Animal and Rangeland Sciences

Student research work will be: In-person lab/field

Project Abstract:

In the United States, the wild horse and burro population has drastically exceeded the carrying capacity of the public lands where they are managed. The overcapacity of wild horses and burros greatly lowers the availability of resources for the horses to maintain humane lifestyles. Current contraceptive methods for female wild horses include surgical (removal of ovaries), hormonal (progestogen, gonadotropin releasing hormone (GnRH)), and immunologic (porcine zona pellucida, GnRH) methods. With the exception of surgery, all the listed methods are temporary, short term solutions. Of the immunologic contraceptive methods, many do not involve the targeting of the ovarian primordial follicles, and this allows for the continuing development of these follicles. An ideal immunocontraceptive would target primordial follicles, thereby resulting in permanent nonsurgical sterilization.

Sperm Protein Reactive with Anti-Sperm Antibody (SPRASA) is a sperm surface membrane protein that may be involved in sperm-egg plasma membrane adhesion and fusion during fertilization. SPRASA is present in the granulosa cell and oocyte cytoplasm in all follicle stages in humans, mice, cows, cats, and dogs. Additionally, mice immunized against SPRASA became infertile. Research from our laboratory has shown that SPRASA is expressed in the granulosa cells of primordial, primary, secondary, and pre-ovulatory ovarian follicles in both domestic (Equus caballus domesticus) and wild horses (Equus caballus ferus). It is not known if immunizing horses against SPRASA will evoke the same immune response or induce infertility as observed in mice.

The objective of this research is to determine the safety and efficacy of a SPRASA vaccine in horses.

The Job - Project Description:

Vaccine development

The process for creating a vaccine requires synthesis of the target protein (SPRASA), selection of a species-appropriate carrier protein, and selection of a species-appropriate adjuvant. A short SPRASA sequence with has 8 available cysteines will be used to develop this immunocontraceptive vaccine. The available cysteines will improve the conjugation of SPRASA to the carrier protein as well as improve the orientation of SPRASA on the carrier protein so that it will be recognized by the immune system. This is the same sequence that was used to develop a SPRASA vaccine for mice. An E. coli expression system (from Genscript) will be used to synthesize 15 mg of SPRASA peptide.

The SPRASA protein will then be conjugated to the carrier protein. The carrier protein CRM 197 (from Fina Biosolutions, LLC) will be used for this vaccine because it is superior to other available carrier proteins because it has a greater apparent capacity for conjugation sites and behaves like a toll-like receptor ligand which boosts the response to the adjuvant. CRM 197 is a non-toxic mutant of diphtheria toxin that is highly immunogenic and commonly used in commercially available horse vaccines. The SPRASA-CRM 197 complex will then be mixed with an adjuvant solution. For adjuvant selection, immunostimulating complexes (ISCOMs from ISCONOVA) will be used because it is the only adjuvant that has multiple adjuvant properties, including inducing cell-mediated immunity. ISCOMs are open cage-like complexes that are built up by cholesterol, lipid, immunogen, and saponins from the bark of the tree Quillaia Saponaria Molina. The ISCOMS adjuvant has over 20 years of safety and efficacy data from commercially available horse vaccines. For each vaccination, 1 mg of SPRASA peptide will be included in each 1 mL of vaccine.

Vaccine trial

In preparation for a live animal study at Oregon State University, an Institutional Animal Care and Use protocol for this research has been approved (IACUC-2020-0103). For this research, the novel SPRASA vaccine will be administered three mature horses to test the safety and efficacy. Safety has not yet been established for this experimental vaccine in horses.

Horses will receive a total of three vaccinations (an initial vaccine and two boosters) administered at 3-week intervals. The horses will be housed at the Oregon State University Horse Center facilities (stalls and paddocks) for the duration of the study. Horses will be monitored twice daily for a 7-day baseline period prior to immunization to determine normal appetite, attitude, and body temperature, pulse, and respiration rate.

A baseline venous blood sample (5 mL) will be collected immediately prior to administering the 1st SPRASA immunization (day 1). For each immunization, 1 mL of vaccine will be administered intramuscularly into the caudal thigh muscles. The injection site will be monitored daily for any observable changes (swelling, warmth, discomfort) that might represent a local change from the vaccine. In addition, the horses will be monitored for three weeks following vaccination to determine if there are changes in appetite, behavior, and body temperature. Immediately prior to the next immunization, a second blood sample will be collected 3-weeks after the first immunization (day 22). Then the 2nd SPRASA immunization will be administered. The horses will again be monitored for three weeks to observe for any adverse effects. After the three weeks of monitoring, another blood sample will be collected and the 3rd SPRASA immunization will be administered (day 43). The horses will be monitored for three weeks again and then the final blood sample will be collected (day 64).

Antibody detection

After each blood collection during the vaccine trial, the blood will be allowed to clot for 30 minutes at room temperature in a Vacutainer® tube without any additives. The blood tubes will then be centrifuged at 10,000xG for 15 minutes and the supernatant (serum) will be transferred into a labelled storage tube.  Serum will be stored at -20°C until analyzed for SPRASA antibody titers.

The SPRASA antibody titers will be determined from harvested serum samples using an enzyme-linked immunosorbent assay.  Briefly, 96-well plates will be coated overnight with 5 µg/mL of SPRASA peptide in sodium bicarbonate coating buffer (pH 8). Plates will be washed with a wash buffer (phosphate buffered saline (PBS) with 0.05% Tween-20). Plates will then be blocked with 0.5% bovine serum albumin in PBS for one hour at room temperature. Plates will be washed again before being plated with serum in a serial dilution and incubated for one hour at room temperature. Plates will then be re-washed and incubated at room temperature with1:2000 recombinant protein G conjugated to horseradish peroxidase. Plates will be washed a final time before adding 2,2'-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid to visualize bound recombinant protein G and then be read on a plate reader at 5, 10, 15 and 20 minutes. Antibody-free equine serum (from Innovative Research) will serve as a negative control to confirm no antibody response in the vaccinated horses.

Data analysis

Microsoft® Excel will be used to record monitoring data from horses. All statistical analysis will be performed using SAS Version 9.1. All of the examined features will be summarized using descriptive statistics (mean, standard deviation, median) and graphs. Changes in SPRASA antibody titers within individuals will be analyzed by analysis of variance with repeated measures. A value of p<0.05 will be considered significant.

Description of work environment:

The work will be divided equally between time in the campus laboratory (Weniger Hall) and at the Oregon State University Horse Center.

Description of Student Responsibilities:

The student will be responsible for working on the project an average of 5-10 hours a week, keeping an accurate laboratory notebook, and maintaining good communication with the research team and Dr. Kutzler.

Skills:

The student will conjugate carrier proteins and adjuvants to the target antigen. In addition, the student will closely monitor the health and well being of the horses used in the vaccination trial. Finally, the student will perform enzyme-linked immunosorbent assays for the detection of antibodies from the vaccinated horse serum.   

Learning Outcomes:

The student will learn about vaccine development and veterinary monitoring of horses. The student will learn how to perform an enzyme-linked immunosorbent assays.   

Expected start and end date: 21-Jun-21
Anticipated hours per week: 5-10 hours/week   
Anticipated hourly wage: $12/hr

Defining the habitat characteristics and preferences of Coastal Cutthroat Trout and Coastal Giant Salamanders in headwater streams in Oregon

Faculty Mentor Name: Ivan Arismendi
Faculty Mentor Department: Department of Fisheries and Widllife

Student research work will be: Hyrbid of remote and in-person

Project Abstract:

Climate change may be effecting headwater stream biota by increasing the synchrony of high temperature maxima and low flow minima. Habitat refugia and cover can play an important role in the survival of aquatic vertebrates during periods of low flows during the summer months. The importance of such features is relatively well understood in larger streams ,but the importance of such habitat in headwater streams has received little attention even though headwater streams comprise the majority of the stream length within watersheds. The first goal of this project is to assess characteristics of the available habitat features in two headwater streams in the coastal range of Oregon. Habitat characteristics that will be measured will include substrate size, canopy cover, refuge features (i.e. wood jams and undercuts), and hydrological characteristics such as riffles and pools. The second goal of this project will be to describe the preferred habitat features of Coastal Cutthroat Trout and Coastal Giant Salamanders by locating fish and salamanders in their natural habitat during the summer using mobile tracking techniques from a Masters student and undergraduate student thesis project. Results from this undergraduate project will be used to inform resource managers about essential and crucial habitat features that are important for the survival of trout and salamanders during periods of hydrological stress.

The Job - Project Description:

This position will work closely with a master's student to collect data on coastal cutthroat trout and coastal giant salamander movement and ecology throughout a stream network in a City of Corvallis-owned watershed. Movement data of trout and salamanders has been getting collected since summer 2020. The purpose of this position is to supplement the existing movement data with a comprehensive assessment of available versus occupied habitat of trout and salamanders. The goal is of this project to understand the importance of various habitat features to the seasonal movement of trout and salamanders.

Description of work environment:

This work will take place in streams in the City of Corvallis Watershed (20 minutes SW of OSU main campus).

Description of Student Responsibilities:

Students will spend their appointments measuring habitat characteristics in two headwater streams. This includes measuring substrate size, canopy cover percentage, number of wood jams, number of undercuts, and frequency of riffles and pools. Students may take measurements on additional habitat characteristics such as stream flow and stream temperature. Additionally, the student will use a mobile tracker to detect tagged trout and salamanders, and then record habitat metrics associated with the location of the detection. This work involves walking up to 5 miles per day in a stream carrying 25+ lbs. of equipment. Students should be comfortable working around water and in inclement weather. Towards the end of the season, the student may have the opportunity to analyze the results and create publication ready graphics using R programming.

Skills:

  • Attention to detail
  • Ability to use a field computer
  • Ability to stand/walk in streams for extended periods of time
  • Use of R programming

Learning Outcomes:

Students will learn about aspects in study design and data collection. Students will become competent in taking field measurements and recording data using a field tablet.  

Students will have the opportunity to learn about data analyses using a computer programming language (R). Students will be able to link this project with overall concepts in trout, salamander, and stream ecology.

Expected start and end date: June 15 - September 15
Anticipated hours per week: 20-Mar
Anticipated hourly wage: $13/hr

Effects of human-induced stressors on eelgrass and its associated communities (from microbes to animals)

Faculty Mentor Name: Fiona Tomas Nash
Faculty Mentor Department: Department of Fisheries and Wildlife   

Student research work will be: Hyrbid of remote and in-person

Project Abstract:

The seagrass Zostera marina (eelgrass) creates critical habitats in estuaries worldwide, providing food and shelter for many organisms. Unfortunately, seagrasses are threatened by several human-induced stressors, such as climate change, pollution, or invasions. This project will perform field work (sampling in Oregon estuaries), mesocosm experiments (at Hatfield Marine Science Center) and laboratory analyses (at OSU) to examine the effects of warming on eelgrass communities, with particular emphasis on effects on disease susceptibility. The student will gain skills in experimental design, seagrass and microbial ecology, as well as field and laboratory sampling techniques, and will be interacting with graduate and undergraduate students involved in different aspects of the project.

The Job - Project Description:

This project entails several different types of activities. On the one hand, there will be field work conducted in two Oregon estuaries, Coos Bay and Yaquina Bay. In these estuaries we will sample the intertidal eelgrass beds during the summer tides, where we will conduct in situ counting of seagrass parameters, and where we will also collect samples that will be transported in to the laboratory, where we will measure different plant traits, including disease and we will also characterize the invertebrate communities associated with these beds as well as the seagrass microbiome. In addition to this sampling, we will collaborate with researchers from Florida and will use drones to create maps of the seagrass beds sampled. The overall goal is to relate the extension of the meadow to seagrass health and disease presence.

In addition to the field work, we will conduct experiments at Hatfield Marine Science Center, in which we will use mesocosms under controlled conditions to grow seagrass and submit this seagrass to stressors (e.g. warming, disease) to examine the capacity of seagrass to resist and recover from stressors and assess the role that the associated microbes have in helping with such resistance. This will require some intensive work during the setup and break down of the experiment, plus more regular maintenance work throughout the duration of the experiment.

In addition to field and experimental work, the student will also be involved in laboratory work. Depending on their prior skills and interests, they can focus more on sample processing to examine plant traits and animal communities and / or perform molecular work to extract and characterize the microbial communities associated with seagrass.

Description of work environment:

Main work will be based in Corvallis OSU campus, where the student will be performing lab work in collaboration with other undergraduates and under the supervision of the PI and collaborators (graduate students and co-PI Dr. Mueller from Dept. Microbiology). Field work will be conducted in two estuaries in Oregon (Coos Bay and Yaquina Bay). When performing this fieldwork, housing and transport will be covered by the PI. In addition, mescosom work will be performed at Hatfield Marine Science Center. Transport to and fro Corvallis and Newport will be covered by PI.   

Description of Student Responsibilities:

The student will be involved in different activities that require different organizations and logistics. For example, laboratory work will imply a regular normal schedule Mon-Fri 9am – 5pm (approximately; hours are flexible). On the other hand, given that the field sampling times are driven by the tides, this means that field work can imply some early morning rises and long days of work (in order to process the time-sensitive samples collected during the morning). Those long work days however, will be restricted to two tide series (one towards the end of June and one towards mid-July), each lasting about a week, and which may include weekends.  After these more intensive days, students can take a longer break to rest and reset. Regarding experimental work, schedules will be similar to those of the laboratory, although there may be some more intense longer days at the beginning and the end of the experiment for the setup and breakdown.

Students will be involved in the fieldwork (e.g. counting seagrass, collecting water samples), in helping with the setup (e.g. setting up tanks and pipes to grow seagrass in a seawater system, collecting the plants, measuring the plants) and maintenance of the experiments, and with laboratory work (e.g. culturing cells of seagrass wasting disease, identifying and counting invertebrates under the microscope, extracting DNA), as well as in recording data and entering the data in a database.

Skills:

The student will gain skills in experimental design, skills in field and laboratory sampling techniques, particularly regarding seagrass physiology and ecology, marine invertebrate taxonomy and ecology, microbial ecology, and molecular biology.

Learning Outcomes:

Students will develop an understanding of the organisms, environments, and ecological processes occurring in estuarine systems, particularly regarding the ecological processes that affect estuarine habitats, such as seagrass beds, and how different environmental (e.g. warming) and biological (e.g. disease, microbes) factors affect not only the health of the plant but also of the habitats they form and the species that depend on them (e.g. invertebrate epifauna).

Students will develop the ability to understand how experimental design works (for both field sampling and manipulative experiments) and will also be able to evaluate seagrass physiology and ecology, characterize faunal communities and have an understanding of molecular biology approaches to the study of plant – microbe interactions.

Expected start and end date: June 14th to August 22nd 2021
Anticipated hours per week: minimum of 20, all the way to 40 (40 preferred)   
Anticipated hourly wage: $12/hr

Impact of probiotic addition to honey bee gut microbiome composition and diversity in the context of pathogenic infection

Faculty Mentor Name: Maude David
Faculty Mentor Department: Department of Microbiology

Student research work will be: Hyrbid of remote and in-person

Project Abstract:

Abstract: Honey bees (Apis mellifera) are cornerstone pollinators and contribute nearly $20 billion to the U.S. agricultural economy each year. Honey bee populations have drastically declined by an estimated 30-40% in the past three decades, and 2019 marks the largest winter hive loss ever recorded. Bee decline threatens the U.S. economy and food supply, which has driven agricultural stakeholders and the scientific community to investigate reasons for honey bee deaths. A number of factors have already been identified, including habitat and foraging space loss, pesticide exposure, and one of the most widespread: infection by parasites, fungi, and viruses, such as Nosema ceranae. In this project we aim to investigate the impact of probiotic supplements on honey bee gut microbiota and the potential of these products to mitigate honey bee health in the context of N. ceranae infection. We hypothesize that the addition of probiotics will increase the functional capacity of the honey bee gut microbiome and impact its role in immunity during infection. We aim to assess the colonization as well as the diversity of the microorganisms in the bee gut following probiotic treatment in the context of pathogenic infection by N. ceranae.

The Job - Project Description:

BACKGROUND: Honey bees have a commensal community of microbes aside from pathogens that include bacterial, viral, and eukaryotic species, collectively known as the microbiome. Like in most organisms, the microbiome in bees plays an important role in nutrition and shaping host health through immunity and disease susceptibility. The extent to which the honey bee gut microbiome influences health outcomes remains unclear. 16S sequencing has revealed that a remarkably simple and spatially organized microbial communities of about 8-10 bacterial phylotypes occupy the honey bee gut, consistent across geographic distributions of bees. In recent years probiotic products have become of interest, in an effort to boost honey bee gut health and potentially protect against pathogens. However, it is unknown whether these probiotics colonize and confer the effects they claim. We hypothesize that the addition of probiotics will increase the functional capacity of the honey bee gut microbiome and impact its role in immunity during infection. We aim to assess the colonization as well as the diversity of the microorganisms in the bee gut following probiotic treatment in the context of pathogenic infection by N. ceranae.

APPROACH: In June 2019 and June 2020, experimental honey bee cages were set up in collaboration with the Honey Bee Lab at Oregon State. Cages contained approximately 150 bees each. In triplicate, cages were subjected to one of four experimental treatments: addition of SuperDFM probiotic, addition of ProDFM probiotic, addition of N. ceranae, and addition of pollen as a nutritional supplement (to mimic the bees’ diet in the wild). Bee midgut samples (the region of the gut where Nosema resides) were collected before, during, and after the three-week experiment.

METHODS: Honey bee midguts (about 300) will be homogenized and total DNA will be extracted (Qiagen PowerSoil kit). PCR will be performed on samples to amplify the bacterial 16S gene using V4 region primers as per the Earth Microbiome protocol. Samples will be prepped for quantification and sequencing which will take place at the Center for Genomic Research and Biocomputing sequencing core on campus. Reads will be processed using DADA2 denoising after QC and paired, in order to identify amplicon sequence variants (ASVs), and analyzed using Phyloseq in R. We will perform taxonomic assignment using RDP classifier and PICRUSt will be used to infer functional capacity from sequences.

EXPECTED OUTCOMES: We expect to determine 1/ if the supplementation of probiotics had an impact on the microbial community 2/ if addition of probiotics affected incidence or mortality rate of Nosema infection 3/ We will also will identify specific ASVs that seems to be correlated with such effects. The collection of 16S gene amplicon corresponding to the set of the bacterial taxa present in bees' guts will be identified and compared between treatment groups, and functional capacity will allow some insight into the role of the gut microbiome in host immune response to N. ceranae infection within the honey bee host.

Description of work environment:

Student will primarily be located in the David Laboratory in Nash Hall. This BSL-2 certified lab includes ample bench space, a large and small benchtop centrifuge, a biosafety cabinet, a chemical fume hood, an anaerobic chamber, a thermal cycler, gel rigs, and general laboratory equipment and supplies necessary for molecular and microbiology research. Student will have access to their own bench space for the duration of the project. Student will also have access to a dedicated desk space in the David Laboratory shared office space located next door to the wet lab.

Description of Student Responsibilities:

Student's responsibilities will include DNA extraction of ~96 or more samples per week for the first few weeks, followed by performing PCR and product cleanup using kits provided in the weeks after. This will require the student to spend 15-20 hours in the lab per week. Other daily and weekly tasks will include contributing to the general lab responsibilities of autoclaving, cleanup, glass washing, restocking pipette tips, and ordering materials as directed by the supervising graduate student or PI. Student will be expected to attend weekly lab meetings as well as a weekly one-on-one check-in with supervising graduate student.

Skills:

Laboratory experience is not required for this project, as all training will be given by the graduate student. Student is expected to be proficient in general verbal and written communication, time management and organizational skills, use of a lab notebook, computer skills including use of Excel and Word, and ability to gather and read literature on relevant topics

Throughout the course of the project the student will learn molecular biology techniques including PCR, DNA extraction, gel electrophoresis. If time permits, student will also learn how to process and analyze sequence data using R.

Learning Outcomes:

Student will learn the general concepts of microbial ecology that this project requires: basics of a microbiome and its interactions with the host, what techniques we use to assess this relationship, and how to interpret results. Ultimately the student will also learn to synthesize and present results to the lab group, and ideally would have an opportunity to present a poster at an undergraduate research symposium as well.

Expected start and end date:

Project will start after the 2020-2021 academic year ends, but the date is flexible. Late June start date preferred. Ideal start and end dates would be June 28 - July 30.

Anticipated hours per week:

The funding for this project from this grant will allow for 4-5 weeks of part-time employment, the student is expected to work between 15-20 hours per week during the course of the project.   

Anticipated hourly wage:

The anticipated hourly wage for this project will be $12 per hour.

Monitoring co-occurring contaminants in the Willamette River: spatial and temporal patterns

Faculty Mentor Name: Manuel Garcia-Jaramillo
Faculty Mentor Department: Department of

Student research work will be: In-person lab/field

Project Abstract:

Decades of intensive agriculture, together with industrial activities and urban development has derived in an increase in the occurrence and concentration of pollutants in water and sediments, including pesticides and their degradation products, nanoplastics, per- and polyfluoroalkyl substances (PFAS), Polycyclic aromatic hydrocarbons (PAHs), polychlorinated biphenyls (PCBs), dioxins and furans, pharmaceuticals, and personal care products. The co-occurrence of these complex contaminants mixtures in surface waters is yet to be determined. In addition, recent studies in stream samples have shown that acutely toxic concentrations of organic contaminants in streams can go undetected by fixed-interval sampling programs. Therefore, we will compare spatial and temporal patterns in occurrence of detected contaminants in daily composite samples to those in weekly and monthly composite and discrete samples of surface water collected from the Willamette River (WR) at several locations in Corvallis, Oregon. This project is part of a larger effort dedicated to monitoring and predicting spatial and temporal patterns of co-occurring contaminants in river basins. The student will learn active and passive sampling techniques for collecting water and sediment. In addition, the student will work at the lab on sample preparation procedures aimed to improve the detection and quantification of organic contaminants and nanoplastics by untargeted liquid chromatography mass spectrometry analysis. The student will also get introduced to state-of-the-art technologies for rapid and high-throughput toxicity screening of these pollutants. Depending on interest and performance, the student will have the opportunity to get further involved in these analyses.

The Job - Project Description:

Description of work environment:

Description of Student Responsibilities:

Skills:

Learning Outcomes:

Expected start and end date:
Anticipated hours per week:
Anticipated hourly wage: $/hr

Low-cost, rapid laboratory and field tests for industrial hemp evaluation

Faculty Mentor Name: Paul Hughes
Faculty Mentor Department: Department of Food Science and Technology

Student research work will be: Hyrbid of remote and in-person

Project Abstract:

The rapid growth of industrial hemp has led to it becoming the largest value agricultural commodity in Oregon. This together with the legal constraints on the various categories of hemp have generated a significant up-tick in analytical requirements and support. In our laboratory we have been developing methods on portable instrumentation, such as a gas cylinder-free GC-FID and rapid whole extraction methods. As the only utility requirement is a single phase (115 V) electrical supply,  

This project will focus on optimizing extraction and analytical methodology and subsequent testing in the field. The analytical focus will be on the determination of (THC + THCA) and (CBD + CBDA) to generate pass/marginal/no pass outcomes. Additionally laboratory investigations will aim to determine concentrations of key essential oil components, such as myrcene, farnesene and the caryophyllene/caryophyllene oxide ratios.
Ultimately the aim is to provide on-the-spot evaluations to guide field evaluation and plant heterogeneity on a farm-by-farm basis.

The Job - Project Description:

The job requires the

Description of work environment:

Laboratory research

Description of Student Responsibilities:

Skills:

Learning Outcomes:

Expected start and end date: 8/22 - 11/5 2021
Anticipated hours per week: 10
Anticipated hourly wage: $15/hr

Monitoring co-occurring water contaminants in the Willamette River: spatial and temporal patterns

Faculty Mentor Name: Manuel Garcia-Jaramillo   
Faculty Mentor Department: Department of Environmental and Molecular Toxicology

Student research work will be: In-person lab/field

Project Abstract:

Decades of intensive agriculture, together with industrial activities and urban development has derived in an increase in the occurrence and concentration of pollutants in water and sediments, including pesticides and their degradation products, nanoplastics, per- and polyfluoroalkyl substances (PFAS), Polycyclic aromatic hydrocarbons (PAHs), polychlorinated biphenyls (PCBs), dioxins and furans, pharmaceuticals, and personal care products. The co-occurrence of these complex contaminants mixtures in surface waters is yet to be determined. In addition, recent studies in stream samples have shown that acutely toxic concentrations of organic contaminants in streams can go undetected by fixed-interval sampling programs. The goal of this project is to compare spatial and temporal patterns in occurrence of detected contaminants in daily composite samples to those in weekly and monthly composite and discrete samples of surface water collected from the Willamette River (WR) at several locations in Corvallis, Oregon. This project is part of a larger effort dedicated to monitoring and predicting spatial and temporal patterns of co-occurring contaminants in the WR basin, helping to prioritize for toxicity assessments and regulation.

The Job - Project Description:

Traditional water quality assessments include temperature, pH, biochemical oxygen demand (BOD), total solids (TS), nutrients (N and P) and pathogens (i.e. Escherichia coli). In addition to basic chemical, physical and biological parameters, water quality is determined by the presence and concentration of naturally occurring and man-made contaminants. These compounds include combustion byproducts, current-use pesticides, legacy or banned pesticides, certain priority metals, and can cause impairment to aquatic life and human health. Another group of contaminants, often called pollutants of emerging concern, are usually not monitored due to the analytical challenges associated to their detection and quantification in water samples. These are a wide range of contaminants, including highly polar pesticides and their degradation products, nanoplastics, per- and polyfluoroalkyl substances (PFAS), Polycyclic aromatic hydrocarbons (PAHs), polychlorinated biphenyls (PCBs), pharmaceuticals substances such as synthetic birth control hormones, steroids, antibiotics, antidepressants, and mood stabilizers, and personal care products. Some of these contaminants have been detected in the Willamette River but have no state water quality criteria or Environmental Protection Agency (EPA) recommended benchmarks.

In addition, recent studies in stream samples have shown that acutely toxic concentrations of organic contaminants in streams can go undetected by fixed-interval sampling programs. Data related to the spatial and temporal patterns in occurrence of pollutants of emerging concern is very limited.

Our lab is interested in the co-occurrence of these complex contaminant mixtures and the study of their temporal and spatial patterns. We will compare their presence in daily composite samples to those in weekly and monthly composite and discrete samples of surface water collected from the Willamette River (WR) at several locations in Corvallis, Oregon. Gathering information about their temporal and spatial co-occurrence of contaminant mixtures will help us to prioritize for toxicity assessments.

Detection and identification of contaminants in aquatic environments is currently highly limited by the availability of analytical standards, equipment, and expert knowledge. As a result, new assessment methods such as nontarget approaches based on high-resolution mass spectrometry (HRMS) may provide more comprehensive and realistic evaluations of chemical occurrence and risk. Unlike targeted analyses, which rely on the analysis of reference standards for primary method optimization and compound identification, HRMS-based suspect and nontarget screenings use accurate-mass MS and MS/MS (experimental or in silico) spectra to generate tentative chemical identifications for large numbers of analytical detections without the initial use of reference standards. Liquid-chromatography (LC) coupled with HRMS is widely used for the determination of water contaminants. HRMS has been shown to be particularly useful in the identification of emerging substances in water. Nowadays, the major challenge is the analysis of highly polar compounds at trace concentration levels in aqueous environmental samples.

Our lab is aim to address some of these analytical challenges and this project is part of a larger effort dedicated to monitoring and predicting spatial and temporal patterns of co-occurring contaminants in river basins, as well as to assess the utility of coupling rapid HRMS analysis with chemo and bioinformatic tools designed to predict toxicity.

Description of work environment:

Laboratory work will be combined with field work near campus. Our Water Quality Toxicology laboratory is located in ALS 1081. Field work will be performed in several locations along the Willamette River (WR) in Corvallis, Oregon.

Description of Student Responsibilities:

The student will help with study area mapping and participate in several sampling campaigns from July to November 2021. The student will assist the PI, Master students, and/or PhD student in collecting water and sediment samples from several location near campus, helping to transport and storage the samples in our walk-in freezer at the ALS building in campus, printing labels, preparing bottles for sampling campaigns, cleaning materials needed before and after sampling days, maintaining records of samples in laboratory notebook and/or iPad, and helping to prepare samples to be analyzed by liquid chromatography mass spectrometry (LCMS) analysis.

Skills:

The student will acquire experience and get familiarized with:

  • Study area mapping using geographic information system (GIS)
  • Water and sediment sampling techniques
  • Monitoring basic chemical and physical properties in surface waters
  • Basic wet laboratory techniques
  • Introduction to solid-phase and liquid-liquid extraction procedures
  • Data collection, and data analysis
  • Centrifugation, autoclaving, pH meter

Preferably, student will have previous experience with GIS mapping and willingness to participate in field work near campus.

Learning Outcomes:

The student will participate in water quality monitoring campaigns, and learn active and passive sampling techniques for collecting water and sediment. In addition, the student will get familiarized with sample preparation procedures, aimed to improve the detection and quantification of organic contaminants and nanoplastics by nontargeted liquid chromatography mass spectrometry (LCMS) analysis. The student will get familiarized with Basic wet laboratory techniques and laboratory practices, data collection, data analysis and data report. In addition, depending on interest, time and performance, the student will have the opportunity to be introduced to these LCMS analysis, assisting the PI, Master student, and/or PhD student in instrument operation and data processing

Expected start and end date: From July to November
Anticipated hours per week: It is expected a minimum of 15h per week during Summer term and 10h per week during Fall term
Anticipated hourly wage: $13/hr

Sustainable technologies to reduce food waste

Faculty Mentor Name: Michael H. Penner
Faculty Mentor Department: Department of Food Science and Technology

Student research work will be: Hyrbid of remote and in-person

Project Abstract:

This project aims to contribute to the development of economically viable, chemistry-based technologies to reduce food waste and thus foster more sustainable food systems. The project includes two broad approaches to food waste reduction. The first approach is to improve the functional properties of food processing byproducts such that these materials can be used for subsequent food applications (rather than being deemed low-value byproducts). This work involves extending our understanding of the functionality of major components present in food byproducts (e.g., proteins, fibers, antioxidants), developing recovery methods to selectively enrich the different components in food byproducts, and developing methods to alter the functionality of these components in a food-safe manner and thus expand their applicability in formulated foods. ‘Functionality,’ as used herein, refers to properties of food components that dictate their behavior in actual food products – such as their impact on foams, emulsions, oil retention, color stability, etc. An example of this type of work is the development of methods for improving the water retention properties of brewers spent grains for applications as, among other things, meat extenders. The second general approach used in this work is to develop technologies to improve the general acceptability of existing nutrient-rich foods and thus minimize their waste. This work focusses on food-safe methods to modify the sensory properties of foods, such as aroma, taste, and appearance. An example of this type of work is the development of strategies for improving the consumer acceptability of cruciferous vegetables.

The Job - Project Description:

Description of work environment:

Description of Student Responsibilities:

Skills:

Learning Outcomes:

Expected start and end date:
Anticipated hours per week:

Anticipated hourly wage: $/hr